/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_074106333cd21b3e482aecb66abcf0f3 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1223558 -w 120 -web -o /tmp/images/bd_log_output_file_074106333cd21b3e482aecb66abcf0f3
Transcript Name :
Pytiw_DAOMBR242034snap_masked-piw_contig_1-abinit-gene-0.66
Orientation:
(+)
Number of Exons:
5
Description :
Serine protease family S28
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4140.57632
InsideOutsideTMhelix
1-663
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2316 bases(100 bases per row)
ATGAACACGCGCTCTGCTCTGTCGCGTCTGGCGGCGCTCGCCGTCTGCTACACGAGCGCGAGCCTCCTGAGCCTGAGCGCCGACGCGTCGGCCGTGATCT
TCCCCGAGTACGCCAAGGGCGGCGAGCTCTGGCGCGCCATTCAGGCGCAGACTCAGTCGCTCTTCGACGTCAAGGCGCCCGAGCTCTGGTTTACGCAGCA
GATCGACCACTTTGTGACTGCCAGCAAGGACGCGAATGACAAAACGGTGGCGAACACGACATACCAGCAGCGCTACTATGAAGTCAACACGTTCTGGAAC
AAGCCGAACGGACCCGTGATCCTCTACATTGGCGGAGAAGGCGAGCTGCTGAACGCCCCCGCGGGCTTTGTATCGGTGATCGCAGAGAAATTTGGCGCAA
AGGTGTGTACAAGTTTGCGTTATGGGATGGAAAATGGCGTATTTGTTCAGTCTGATAAGCTAACATAGGTCTATGGTATGACTACAGATCCTGGCGCTGG
AGCACCGCTTCTATGGGAAGAGCGTTCCGAACGGCAACCTCGAGACGGAGAACTACAAGTTCCTGGCGGTGGAGCAGGCGCTCGCCGACCTCAAGCACTT
CAAGGAGTCATACCAGAAGACGCTCCCTGGCGCCAGCAACAAGTGGATCGCGATCGGCGGCTCGTACCCGGGCGCGCTCTCGGCCTGGTTCCGCATCGCG
TACCCGGATACGACGGTCGCGTCGCTCTCGTCCTCGGGTGTCGTCGAGCCCGTGTACAAGTTCTTCGAGTTTGACGAGCAGGTCGCGCTCTCGGCCGGCG
AGAAGTGTGCCGACGTGCTGCGCAAGACGACCGCGGCGTTCGAGGAGCAAATCAAGAACGGCAATGCGACGCACGTCAAGGCGCTCCTGGGCGCGCAGGA
CCTCTGCGACGCCGACTTCCACTACATGATCGCGGATGCCGCGGCCATGGCGGTCCAGTACGGCCACAAGAACGTCGTCTGCGATCACATGATGAGTGCG
TACGAGAAGAAGCAGTCGCTCACCGAGCAGTTTGCGAACTTCACGATCACCATGTATGGCAGCGACTTTGGCAGCGGCTGCTTCTACGACACGACGTGCC
TCATCCGCGACAAGAGCCGCTGGAGCAGCGGTTTGCGCTCGTGGCGGTGGCAGAAATGCTCGCAGCTGGCGTACTTCCAGGTCGCACCCAAGGAGAACAG
CTTGCGTTCGTCGATCGTGGACTTGAACTACCACGAGGAGCAGTGCAAGCTCATCTTTGGCGATGTCGTGAATCCGTCGAAGGGCGTCGCGGCGATCAAG
AAGCTCTACGGTGGCAACAAGCCGCATGGCCACAAGATCTTCTTTGCGAACGGCGGCGACGACCCGTGGCAGCGCGCGTCCGTGCTCAAGTCGATCTCCG
AGGACCAGGTGGCGAACCTGGCGCAGTGCGACCTGTGTGGACACTGCGGTGACCTTCGCGCGGATGAGGACTCCCCCGAGCCACTGAAGAAGCAGCGTGA
GGAAATCTTGCACTACCTGGAGAAGTGGCTCTCGGAGTCGACGGCTGCGGTGGCCCCTGAGGCCCTGAGCCAGCCAGCTGTACAGAGTGACTCGGTGGTG
GCGAAGCGTAGCACTCCAGGCAGCTACCGCTCGACGCCGTTGGTGCTCGTGCCGATCGTGTTTGCGTTCATGGCGCTCGTCGTGATCCTCCACAAGGACA
TTGTGCGCGACTCACCCTCGTGCTCGGGCTACGAGCGACTCACTGGTGTGTAAATCAATACCTCACAACCAGTGCTGTCTGCTGACAAACAGGTCGTATT
GGAAAAAGCTGTCTTTGCCAGAACGAAGTGGAAGACAGTAGAAGGTATGAAGGTGTGACGCCAAGTGTGTTTTCAACAAGGTGTGTGTATGTAAATATGT
GTGTGTTTGTATATCCATCCTTGCTGGCTTGTACCTTGCGCTAGGCTGCGTGCTGCGGACGAACGGGCACGGCCGCGCGGTTCATCTCTCGGTTGGAGAT
GTAGGCGTAGGCGGCGCCGCCGACCGTGACGACGCAGATGCCGAAGAGCTTCTGGTTGGTGATCACGTCGTGGTTGATGGCGATCGAGAGCGTGATGACG
AAGATCTGCTTCATGTTGCCGCAGACGCAGAGCGTAACGGGCGACGTCACTTTATTCGCGTAGAAGCTTGTGACGTTGAGCAGGAAGCTGATGACGCCCG
TGATCAGGTACCACGTCGAGAGCTCCGGGAGCCGGTCCCAGTTGGCCATCAGGATTTGCCACTCGCCCGAGAGCACCATGGCGATGAGGCACCAGAAGGC
CGAGAGCGGCGCCTGA