Transcript Name :
Pytiw_DAOMBR242034snap_masked-piw_contig_1-abinit-gene-0.58
Orientation:
(-)
Number of Exons:
3
Description :
Type I inositol-3,4-bisphosphate 4-phosphatase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8810.89124
InsideOutsideTMhelix
1-4
103-114
165-175
241-260
323-480
25-79
133-141
199-217
281-299
504-1522
5-24
80-102
115-132
142-164
176-198
218-240
261-280
300-322
481-503
*** None ***
PositionContextScore
175ISSRSKR|IW0.795
477KQGKKKR|ST0.562
1416LSGRSKR|MA0.782
TypeScore
endoplasmic reticulum667
GO
*** None ***
*** None ***
*** None ***
Sequence
        5034 bases(100 bases per row)
ATGGCGTCACGCGCGCTCCTCCTGCTGCTGCTTGTAATGGTTTCTCACAGCGTTGCAGGCGCATCGGCGCAGAGCTCGCCTGGTAATGACGGTGGCCTCG
TGTCGCCAGCGTACATGCGCACACATCAGCTTCACGACGCTATCCCTTTCGACAGTGACGATGACCAGGCGACCACAGCGCCAGACGCCGCGGAGGAGAA
CGACGGTCTCGTGTATCTGCCGCAGCCGTCGCTCCCAGTCGAGATGCTCTGCGTGACGATCTACTTGGCGCTCGCGATCGTCGCGGCCTGCAAGGCCATG
TCGCTGCCCACGCGCTTCTCCGCCTACGAGGTGAAGCGCCGCCACACGTTCCAGCGGCTCATGGTGCTCTTTGCACTCACGCGCATGCTGTCGTTCCTGG
GAAAGCGCGTGGCGCGCGACCTGCTCAACCGCGCGGCGCTCTGCTTCTTCTTCTCGCTCGTGCTCTTCCAGGTGCTCTTCTGGATTGACATCGCCAACCC
CAAGATCTCGAGCCGCTCCAAGCGCATTTGGTACGCCTTCGTGCTCGCCAACGGCGTCTTCTACGCGCTCGTGCTCGGGCTCTCAGTCGTCCACGTCTGG
CACGTGTACGCGTACGACCAGTGGGATCAGCCACTCGACGACCACTCGCAGTTGCTCACGGGCGTGCTCCCAGTGCTCCTAATCGCGGCGGGCAGTCTCG
CGAGCTCGCTGGGACTCGTGTACTCGACCTGCAAGATGCGGCGGCGCGTGGGGCGCGTGCTGAAACAGTCGGGCGACGGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACGGCGTCTGGACGAGCGCATCGAGGCCAAGCTCCA
CCGCGCGCTGCGCTTCACGATCGTCGTCATGATTGTTTGCTCCGTGATCTTCCTGCTGCGCACGCTGCTGTACCTTCAGCGGCCGTTCTCGCACCGCGGC
TGTGGCGACATTAGCGACCCGAACGTGTGCATCATCGTCGGATATGCGATCCCAGAGGTCGTGCCCTGTGTGCTCTTCCTCGTCCTCATGTGGGAGGTCG
AGCCGGACATGCAGTTCCCGTCGCGGAGACGCCCTAGCTTTAACGGCCTCGCGACGAACGAGTCCACGCCGCTGCTGTACGACGAGCAGCCGCTGCCGCT
GTCCATCACGACCACATTGCCGCGTAACGGCAGCACTTCCGGTGTCGCGGGCTCCATGGCATTGACATCCAGCTCGCCTGCGAATACAGGAGGTGGCGCA
GTGGTGCGTGGTACGTCGTATCGCATCTCGAATCGACGGTCCAGTCCGCTCTCGTTCGGTCTCGGCGGGAATGTGCTGGAGCAGGCGAGGCGGCGACTCG
AGCTGGTGACGCAGAAGCAGGGCGACACCTCAATAACAGGGAGCGCGTCGGCGTTGTCCTCCCAGACTCACTCGCACCACGCGCCACCACTGTACGACGC
TCGGCTCGTCAGTTCGTCTGGCAATGTGCTGGAGAAATTTGGGAAGCAGGGAAAGAAGAAACGGTCCACGTCGGCGTACGCGCTACCTGTTTCGATTGAA
GCAGCGGTGAGTCTCGAGGCCAGCATGACAGCGTACGCGTGGCTCTCGTTCCAGTGCTTCAGCCTGACTCTCCCGTCATCCTCGGCCACTGCGTCGGTGT
TCTTGGTGCTGCACGTGCTCAACGCCGATACGGGCGACGTGATGCTGGAGATCGGCCGCTCTGAGGTGTCTGCGTCCGAAGATCCGTGCTTCCACCTCAT
GTTGCCAGTGGAGATGCGCGAGCAGGATCTGCTGCGCATCTCGGTCTATTCGATTCGCAACGTGCAGTCGCTTGATCTTAACAGCCAGTGGCTCGTCGGC
GACGCGCTGATCCCGCTGGCATCGTTCATGGAGGCATCCAAGTTTGCGTTCGGGCGAGCAACGCTCCACGCGCTCTTCTCGCCGCTCTCGCGCACGCGGT
CATCGGGAGAAATCGTCGTACGCTGTGAAGCTGAGGTGAAGAGTGCCAGTGGTGTCTCGGACGAAGGCCGCCAACGCATCACGCGCTCGTTCATGTATTT
CTCAACAGAGGAGAGCGACGACACCCATTCAAGCAACAGCGATACAATCGTGGAAGAGAAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTTGTGGCTCGCCACAAGAGCGACCGAGCGGCTTCGCTACAGCACTCGCACGCCAAAGTGC
TCGTCGAAGAAGAGCTGATTGAAAGCGTCTACACGTGGGAGATCCCGTATCAGCTACTGCAGCTGATACTGTCGGACCTGGTCGTGAAGCTCGAAGCGTT
GAAGCGAGAGAATCTGTCGGGTGTCGACTTTGGTAACAGTCTCTCGTCCACGCCGATCAGTCAGATCTCGAGCTTTGGAATGTCGGCGATGCCACCGCCG
CTGTCCACGTCCCCAGGGGCTCTCAGTGTTGTTCCAGAAAGCGAGGGCAACGAAGGTTATATCTCATCTGAAGATGAAAATGGCGACTTTGCTGCACCGC
TCTCCCGGGGCAGTGCAATAGGAGGCACTGGTGCTCTGCCAGATCAGATGAGAAGGTCAACGCCCAGCATTGGCATGCTCTCGGAACTAATTTACCATAT
CCAGGACGATGCCATGGAGAGAAAGAAGAAGAAATGGCGTCACGAACTGGTCGTGACCATGGAGCACTATATCTCCCAGGTTGAGGACGCCATCTTACGC
TACGGAGACACCCAGCATGGTGGACTGACCTTCAAGCCGAGCACCATGAAAGCGGACGCGAACTTGAGCTTCCTGGCGCTGAACCTGCACCAGCAGCTCA
TGACAGTCGGAACAGCGGTGCCGACGTCGCCGAACGATGTGATCTATGGAGACAGTGCGAGCAGTGGCGTGCGGTATGCTCGACTCGTGGACTCGTTTGT
AGGAACGATCTTGGCGTCTCCGTCTCACAAGCTGCGCGAGTCAGCGGAAGACCACATCGCCACAATCCACGACTTGGACAACGAGAACCACAACCACCTT
GACGGCAGCGCCGACAGTGACGGTGAGGGTGAAAGCAACGATGCTGAGGATATTCTGACAGGTGACGAGGACGGCGAGCTTAACAGTGACGAGACTCCTG
TTGAGCCTGTGGAGGCACTACGGCGTCGAGTCATTTCATTTGATTCTGCGGAGAACATTGTGAACATGAGTGCTTCGGGTCGAGAAGTCTCCGTGACAGA
TGAACAGCGCAAGCTTGCAGAGACGATCGTGGCGCTCGGCTTATCAGATCGAGAGCTGCATGGGCTGCAGACCAATGGCGAGGAGCTACTCAGCGCTCCT
CCAAGTGCTCCTGATGACAGTGATGGTGACCAGAAGCCGCACGGGTTTGCCGAGTGGATGAAGGGGAAATGGCGCAAAGTCGAAGAAACGCGGCACAACC
TCGAGGAAAAGCACAACAACAACATCCACACGCCGTTCCAGCACCACCGCATGTACGGCACGACAACGGTGGGGGCATTTGCTGCACACGTGTACGGGTT
CAAGAACGGCGGCATTCGCCAAATGCGTGGAGAGCTGGAGAGAATCCACGTGAACCTTGTTCGTGAAGCGGAGAAATCGAGTTCGGACCTCACACTGGAG
GCGCTGGAGAGGAAGTACCACGAGCTCAAGTGGCATGTCGAGCGGCGTCTTGAGGTCGCTTTTTGCCAGGCGATGAGTGCTTTGGTGACATGTTTCCAGC
AGACACTGTACGTCCATGTCCACGACGGCGTGGAGTTTGGGTCGCACAAGATGCAGCTTCGCGGGATCGAGTACTTGGAGATGGTGTCCCAGGTCGGCTT
TCTCTTCTCAGTCGAGAGTTTGCTCTCAACTTACAGCAACGAGGCAGGGATGCTCGGTGACATGGAAGCCGCCGTGAAGGAGCTCTCCCGCGTGCTCATC
AAGTTGCGACCCGTGCAGACCCCACGTGAGGCAGACTTCCGTGTGTCCATAACCTCAGGTCCACTTGGAATCGTCATTGAGCTGCCGATCATCGTGTGCG
ACCCGAACGATTTCCCAGACCGCAATATGCACCGGGTCCCCGGCCAAGATGCGTTCACTGGCGCTGTCTACTGTCCGCTGACGTCGAACGAGCAGATCGA
CCGAGCGAAGCGCGTGTTTCGGAAGACAATCAGCGTCAAGTCTGTGCTGTTCTCGCAGGGGATGAACGAGATGCAGACGGTCGCCAACACCGTTGGGAGA
GACTCACTGCAGAGAGAAATCAATGCCGAGAACGTCGTCGTGCTGGAGAAATATTACACCTCGTTCGTGCAGTGGTGCAAGAAGCGCGCGCGCAACAGTG
ATCGATCGACCAAGCCCATGCCTGCGGTCTACATCCCGGACGACCTGGAGCGTCTTCAACTGCTTGTTGATCGACTCAAGACAAACATCCAGCTCTCTGG
ACGGTCGAAGCGCATGGCAATCCTGAGTTTGTCGTCTCTGATCGCACGCTCCATCGGCGGTGGGCGCGTTACGTGCTGCAAATCAGCGAAAGACCGCACT
GCGATGTCCATCACGCTCGAGGAGGCCAACCTGCTGGTGTTCTCACACGGTCTCCACTCGGACGAGCGCGATTTGTTCACGAGTCTGCTGCGGACGCACG
GCGTGCGGCGCGAGAACGCGCGCAAGAACATCGGCAAGGCGCAGTACTGTTTCAGCGCACTGCAGAACTACATGCTGCCACACGATTACAAATGCCCGCC
GGGAACTGGCGGTGGGAGTCGCCAGTTCTCGTAA