Transcript Name :
Pytiw_DAOMBR242034maker-piw_contig_1-snap-gene-0.30
Orientation:
(+)
Number of Exons:
3
Description :
Transposase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-331
*** None ***
*** None ***
TypeScore
nuclear696
GO
*** None ***
*** None ***
*** None ***
Sequence
        1088 bases(100 bases per row)
ATGCGCAGCTCGATCGGCAAGCCGTCACCGCCGACGCCAGAGGAGAAGCGCCGTGTGCTGGCCGCTTTCCACCGTCGAGAAGACTGGCAAGCGGTGGCCA
AGCACAACGGCATGGCGAGAGCGACCGCGTGGCAAGTCATGCCCACCAACCGCACAGAGCGCCTGCCGCGCAGCGGAGCTCGTGTCGCTTCCACCAAGTG
TACGCCAGCAATTAAGGAAGCTCTCGAGGACTACGTCAACGACAGCTGCACGTACACGCTGACGCAGATGAAGGACATGCTCGCGTTCGACTTCCGTGTG
GACATCTCTACTTCAGCCATCAGCCGGCGCTTGCTGAGCAAACTGCAGACGATTAAGCAGGCGAGTCTTGCTGTGGGATTGTATACAATGTGTTCTGAGT
ATTGACTGTACATTTGTGTGTGTGTACAAGTGCGTGTTGAACCATCGACATTCAAGAATGAGATCAATAAAGCAAAGAAGGAGGTGTTCGCAGAGCGTTT
GGTGGCACACGAGACAGCTGGCGACTACGTTGCGTTCTACGACGAGGCCAACTTTAACCTATGCTGCAAGCGTTCGCAGGGCAGGTCCAAGGTCTGCTCG
CCCGCTACGCTCGAGCTCCCGCCCTCGGAGGGCCCGAACCTGCAGGTTCGGTGTGCTGTGTCCGTCACGGACGGCGTGCTGCTCCACCGGCTCGAGCGCA
GCAGCATCCGAATGGAGCAGAACACAGACTACGACGACATGTGTGTACGCGGCAGTGAAAGCTTCGCGCGGCTACAACGAGAACTACGCAGGCAAAAAAG
TGGTAATAATATTGGGCAACGCCCCCAGTGCGCTCGCACACCGAGACCAGAGTGGAGTACCACGATGATCTCGTCCTGCTGCGCCTGGGGCCGTACTTGC
CTATGTGCGACCGTATAGAGGGTTGCTTCAGTGTGTTGAAGGCCTCTATCAAGGCCTTCTTGTGCTTGAGTGTTGACGGGACGCTAACACGTCGCAATTC
GTTTGATACTATGACTGAGCAGCGTTTGGATTTGCTTGAAAGAGCAGCTGTGCATGCGACGCCATGCATCACGCCGCACTCGAAATAA