Transcript Name :
Albla_Nc14000340
Orientation:
(-)
Number of Exons:
2
Description :
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        230 bases(100 bases per row)
ATGCAATTGACATATGTGATAGGGCTACTGATCATTGACCAAACTGACTTGATGAAGTGATTTGACTCGGAAGACTCTTTCAACCAAAGATGCTGTCGTA
CGCAACTGCTAGTTGTATCACACGTAATTGTTTGAGAATAAGCCAAAAGTCTCATATTGACTGGGTTATAATTGCAAACGAGTTAACACAAACTGTTTTG
AGCCAAGAAGGACCTCCATCTGGTGATTGA