Transcript Name :
Albla_Nc14000460
Orientation:
(-)
Number of Exons:
5
Description :
lysosomal alphamannosidase putative
This protein is a Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Glycoside hydrolase, family 38, central domain4.8SM00872
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4420.56524
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
zinc ion bindingGO:0008270IEA
hydrolase activity, hydrolyzing O-glycosyl compoundsGO:0004553IEA
KO ID
K12311
K12311
Cluster Id
826
Sequence
        3299 bases(100 bases per row)
ATGATTCCTTTCGTTTACTGCGCGCTGTTACTTACAGTTGGCGCATTTGGATCCAAAGATTCCACTTGCGATCCGTCGAAATGGAAACTGCCCATTGATG
ATCACTACGACACCAAGCCATTCATCTCAAACAAGAAACTGAACGTGCATTTGATCCCGCACACACATGACGACCCGTACCGTAATACCCCTATTACAAG
ACTACAATTTGCTAACTCGCTCTCTGCAGCGGATGGCTTATCAATGTCGACGAATATTACATGCAACGAGTGCAATACATCCTGGACACTGTGGTGGAAG
AGCTGCATCACAATCCCGACAGAAAGTTCATGTACGTCGAACAGGTCAGTGCCCTCTATTCGAATAGGTATCCTTAACTGACACCTACCTCTTAGGCGTT
CTTTCAGCGATGGTGGCATCAGCAAAGTCGCGAGACGAAAAAGAACGTGAAAACGCTCGTGAAAGAAGGACGACTCGACCTGACAGTGAATGGAGGATGG
TGCATGCACGATGAGGCCACCACACACTACACCGCGATGGTGGATCAGACCGCTTATGGCCATCAATTGCTGCATAAAGAGTTCAATATTACACCACGAA
TTGGATGGCAGATTGATCCATTTGGACACTCATCGACTCAAGCGTCGCTTCTTTCAGCTAGTTTGGGATTGGAAGCGTTGTACTTTGCGCGTGTGGATCA
TCAAGATTATGATAATCGGAAAATGAAGAAGAATCTCGAGTTTATGTGGCGTCCTAGCCTTTCACGTGGCAAAGCAGCCCAAGTGTTTACAGGAATTATG
ATTGATCATTACGGTGCTCCTGGTCATCTCCATTACGATCGCGACACTGCGATACAGGATGATCCTACGCTTCATGATTTCAATGTCTGTGAGCATGTGG
ATTGGATCGTGGAGAACGCGCAGAGTCGAAGTAGCGCAACGCGTGGGAATCATATTTTCATACCGATTGGGGATGATTTCACATATATCAACGCTCATCG
ATGGTACAAGAACTTGGACAAGCTGATTGTAGGCATCCTTTTGCTGCATCTTATATTGAAAGCGGGCTGACAACTATGTTTGTGGTAGCACTATGTGAAT
CAAGATGATCGTGTCAACATGCTCTACTCGAATTTGACGTATTATACAGAATTGAAGAGGGCAGAAGGATTGACGTGGACCGTTAAAACGGACGATTTCT
TCCCTTACGCGTCGGCGGAACACGACTTTTGGGTCGGATATTTCACCAGCCGACCTGCATTGAAGCGATTTGTACGAGTTTCAAATACTCTTTTACAGCA
ATTTCGGCAGATCGATGCAGTGTATCAGAGTCATCACGCTGCCAATTTGGTTCCTTTGCTTCGAGCTGCGGCTCTGGTAGAGCATCATGACGGTGTTTCC
GGCACAGAAAAGCAAGCTGTAGCGGACGATTACGCTCTCCGTCTGAATGATGCAATTCTAATAACAGAAAAGAGTATCAACGAAGTGTTACTTGCTGTTG
GCGAATATAAGCACTTGTCCTTGTGTCTTCTCTCAAACGTGAGCATTTGTGATGTCTCGACAGAGTCTCAGGTACCATTCCGTCTTGGGCTTTTTCTGTT
TGTAAAGCTGACTGAACGGTTACTGTAGCGATTTGAAGTGTATATCCACAACGCATTGCCGAGAAACAGCAACCAGACAATCTCCATCCCAGTGACACAA
CAAAACGCGAAAGTGAAAGCGATATCCGATGACATTGTCATTCACAACCAGAAAGTTGTCATCTCACTACCATCCCATCCAAGTCGTCATGAAGAAGCGC
CATACAAATTGGAATTCACTGCAGAGCTGAAACCACTTGTCTTCCATCGATTTATGGTCGAGCAATTCCCACACGAACCGTTCATGGCCGAGAATATTGA
TACGAGACTTTACAGCCAAAGAGCTAGCCCGGGACTCATTTTCATGGAGAATGCATTCACTCGTGTTGAGATTGACACATCGACCGGATCGTTAGTTTCA
GTGTACAACAAAGCGGAAAGGATATCGGTACCGATCACTTTGTCTGTTCTGTACTACAGAGCGTTCCAATCTGGTAGTCCCAAGTCTGGCGCCTACGCGT
TCCGCCCAACGTCGAATATGACGTATCCTGCTGCTGGGGTCAATGGCTCCGACCTTTTCCGCGAACTTGTGGAATGTGTAAATGTCGACACCGAACTGAA
TTCGTACGGAACTCGGACAAAACTAGCGTTCCGTTTGGGGCAATGGGTGACCATTGTGTACAAGCTGAGTGATGTGGACGAATTCGTGGAGGTCGAATGG
ACAGTGGGACCGATTCCTATAATTGATCATCAAGGCAAAGAAGTTATTTTACGAATTGATACCAAAAAAGCGATCCAATCGAATGGAAAGTGGTACACAG
ACTCCAATGGACTCGAATTCGTTGAACGAGTGCGAAATTATCGAGCAACTTGGAACTTGACTATCCACGATGACCAGGAATTCGTCGCTGCGAATTACGC
TCCAGTCACCACAGGCGCCTATATCAAAGATAAATCGATCCAATTGAATGTGGTCACAGACCGAGCGCATGGAGTGGGATCGCTGGAAGATGGGCAGATG
GAAGTGATGTTGCATCGTCGTCTTCTTGTTGATGATGGCAAGGGCGTCAATGAGCATTTGAATGAGACTGAAACGTATACGGATCCGCTGACAAAGAAAA
CGTACACGGACGGATTGGTTGTGCGTGGAACCACTTTTCTTGGCGTGAGTAGTGTCAAAGATGGAATGCGAAGCTTACGCACAAAGATGGAAAACCAGTA
TTATCATCCGCTTGTGCTGTTCAAAAAGTCGAATTCAGACGAGGAATCCCCGCGAATGAAGCTTCCGTGGCTACTTGTGAGCGAATTCCCACCCAATTTG
GGTCTCACAACGATCGAAGAACTTACGAAACGATGCATTCGCATTCGATTGTCTCATTTATACGCTGTGGAGGAGCATTCCGAGCTATCAAAACCCATCC
ACGTCGATTTTGCACGATTATTCAAGTCGAGCAACGCAAAGGAGAATGTCTTGAATGTGGTTGAGTTCAATTTGGCTGGTACGCAGGAAATTCGACCTCA
AGACCGCCTCAATGAGATGACGAGAATCGCTTCTTGGCGCACGGAAAACGACTTTGATCGAGCAGCGTATTCGACTCCGCTTTATGGATCACAAGTGGAA
ATGCAAGCGATGGAAGTTCGCGCCTTCAAACTCTGCTTTGAGTCGAGTGGTGTCAACACAAACGTCGGGCAGATTCACGATCGCGTGTCGCTCAAGTAG