Transcript Name :
Pytar_ATCC12531maker-par_contig_3521-snap-gene-0.1
Orientation:
(+)
Number of Exons:
4
Description :
Protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain48.414PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain1.8SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-340
*** None ***
PositionContextScore
99YIKRKKR|EG0.684
257HRQRSRR|PR0.512
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        1232 bases(100 bases per row)
ATGGACGCCTACGAGTCGGTGCGCATTATCGGCAAGGGTTCGTTCGGCGTCGTGACGCAGATCCGCCGCAAGTCGGACGGCAAGAACCTCGTGTGGAAGG
AGGTCAACTATGGCGCCATGAGCGAGAAGGAGAAGCAGCTCATTGTGAGCGAGGTCAACATCCTGCGCGAGCTGCGCCACCCGCACATTGTGCGGTACCT
CGACCGTGTGATCGACAAGGCCGCGACCAAGATCTACATCGTCATGGAGTACTGCGAAGGCGGCGATCTGAGCCAGTACATCAAGCGCAAGAAGCGCGAA
GGCTCGTACATTGAGGAAAACTTCATCTGGCACATCTTCACGCACGTGTTTCTCGCGCTCAAGGACTGCCATCGCCACCGCGAGGGCAACGTGATCCGCC
CGATTCTCCACCGCGACATCAAGCCCGGCAACATTTTCCTCGACGCCAACGTACGTTTGTTTCCCTAGGGGGCTTGACACCGTCATGGGTTGATACTGAA
AGTGTTAGCTGGTACTATTCAGAACAATGCGAAGTTGGGCGATTTCGGGCTCGCCAAGGAGCTGAGCAGCGAGTCGCGGTTCGCGCAGACCAACGTTGGC
ACGCCCTACTACATGAGTCCCGAGATGGTCAACGAGATGACGTACGACGAGCGCTCGGACATTTGGGCGCTGGGCTGTCTGCTCTACGAGATGGCGACGC
TCGCGTACGTTGGCGTTGGATGTACTAATTTGTGGCATGGCGACTGACAAAACGTGTCTATGTGGAACCACAGTCCGCCGTTCGATGCGACCAACCAGTT
GGCGCTCGCCAAGAAGATCAATGCCGGCAAGTTTGCGCGCATCCCGTCGCAGTACTCGGAGGGGCTCTTCCAGGTGATCCGCTGGATGCTCCACCGCCAG
CGGTCGCGCCGTCCGCGTATCGAAGACCTCGAGCGCGTGCCGCAGTTGCAGCAGCGATTACGCGCGTACGCGGCGGCCAACAGCGCCAACCCGGAGGCGC
AGCAGCGTGCAACCTATGACCAGAAGATGAAAGAGCTGCTGGCCATTGAAGAAGACTTGCGACGACAAGAAGCCGCACTCGTCGCACGCGAAAAGAAGCT
GAAAGGTACGCGCTTCTCCCACATACGACGCTAGTCGGCGGCGTGCATTGGAATTGACACAATGTGCTTGTAGAGCTCGAAATGGATTTCGCGCGACGGG
ATGCCGAGCTGAAGAAGCGGGAGCAAATGTAA