Transcript Name :
Pytar_ATCC12531fgenesh_masked-par_contig_2813-abinit-gene-0.6
Orientation:
(+)
Number of Exons:
2
Description :
Phospholipase D; Pi-TM-PLD
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-69
130-157
208-213
275-325
408-477
93-106
181-184
237-255
349-384
70-92
107-129
158-180
185-207
214-236
256-274
326-348
385-407
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1501 bases(100 bases per row)
ATGCTGGACCAGCAAACGAGTGGCGAGACGAGCGAGGCGAGTCGCCCATCGCGTCGTGGAGAATCCGCTGCCACCGAACGAGTTACAACTCGTGACGTGG
GTTGCCACGATCTCGAAGAAGAAACGGAACAGATCCCGCGGCAGCTCGAGGCCAAGTTCAAGAAGCTCCACGCGGACGCCACACGGGTGCGGGACTGTCT
ATCATCCACAAAAGCCCGATATGCTGATGGTCTAATGTTCTTTCGCGTGGCAGTGGGCGCTAGTGCCCAAGCCGTTTCTCTTGCTCATTGTGTTCTGCGT
GGGATTTGCACTGCTTTCCCTCATTGGGCTGCTTGTCATGGCGACATCATCGTCAGACACAGACGCAAGTGACGAGACGGCATCGTCTGGGTTCCTGTTG
GCCGTCGGCGTGTTCAGCTCCATTGTCGGCAGTCTCCAGACGGCTGCGGGGTACTGTGCTCAGCGACTCAGCCACCAAATCACTGCGCTGCTGCGTCGCC
GTCAACGACCCCAGCGGTCCGAGTCTGCTCGCAAGCACCTGCTGTTTTACGTTGGTTTGCTGCTGCTCGTCTGCGGCACGATCGCGGCGGTCGTGAATCT
GGGCATCCTGGGGCAGAGTGTCACGGCGCCGTTTGCTGCCATGACGCTTGTGTTCAATGGTTGCCTCGCGTTCTTGGTACTTCACGAAGCAGTGACCAAG
ATTGACGTGATTGCGACTGTGCTCGTGCTGTTGGGTGTTGGGGTCGCTATGCTGGGTGTGGGCATGGCACAGCTCAACGCGCAAGCGTTCACGCTCGAAG
ACATTGAATCCACTTTCATGCGGTCGCCGTTCCCGGCCGTGTACTCGGTGACGGTACTCGGCTCACTCATCGCATCGTTTGCAGTCGTCCAGAAGCGACG
CCTTGAGAAGAAACCGGCGGGGCTGTGCTGCTTTTCCATTGGTGCTGGTGTGCTCAGTGGGTTCTCAAGTTTGTGCGTCAAGTGCACGGTCGAAGTCGTG
AAGGGCGTTTCGCAACAGCACTCGAGCGACTTGACTAACCCGGTCTTGTACGTGTTCGTCGCGGGCATTCCAATCTGCGTGCTGTCTCAACTCAAGCTCA
TGACGCTTGGCCTCCAGCACTTTGGCACGCTCAAGTTTGTCCCGCCGTACCACGCGTTTATCATCCTGTCGAACTTGGTCAACGGGATGGTCTACTTCGA
CGAAACGAGGGGCTACGATGCGCTCTCTGCCTCTGTTTTCATCGCGGGGTGTGTTGTGACAGTCTGCGGGATCTTCGCGCTGCTGGCGAAAGCACCGCGA
GTGGTTGATGTGGAAGCCCATGTGAAGGCATCTTTCCAGTCGCCGACTTGTGTGAAGATTGGCGAATCAGCACGAGGCGACAAGATCTCAACGGCCAGCA
CAAGCTCCAGTGGGAGCGATTTCGAAATGACGCCGGCGTTGAGTCTTGAGCCCGCTGTGAAGCCCGACCGTGGTGGCGGAAGCAATGACCTGAATGTCTG
A