Transcript Name :
Albla_Nc14000490
Orientation:
(-)
Number of Exons:
8
Description :
ser/thr kinase putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Serine-threonine/tyrosine-protein kinase catalytic domain6PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain6PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain6PR00109
Serine-threonine/tyrosine-protein kinase catalytic domain6PR00109
Profile scan predictionP-Valprediction_id
Protein kinase domain52.866PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain2.6SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
Cluster Id
2778
Sequence
        3760 bases(100 bases per row)
ATGCAGTCAAAGACGCCACTCCAACGACATTCTGATAAAGCAACTCGAACGGGAACACGCGCTCGATCCAAGGATAGGCAGAATATTCGTCGTCCGTTTG
CATTCCCGTTCAAAAAAGACACCATACGCATCGTTGGAGATTGTTTTGTGCGTGCTTCTCATCTCCTTCTTTATACAGATGTTTATACTGTCCTCCTCAC
TTTGGAAAGCGTAGCAACTCGGTGTGGAGATCGGTCGTGGTGGATTTGGAATCGTATACGCTGCACTGGATCTCCGGAATGGACGCTCTGTTGCCATCAA
AGAAGTGTCTTTGCATGATATCGACAAGGAAGAGCTGCTTTCCATCGAGGTATGCCATATATTCATTCATACAGGGATATAAAATAACCAGATATTATCA
CATATTAGAGTGAGATAAGTTTACTCAAGAAATTAAATCATGAAAATATCGTCAAATATCACGACACCATCAAGACCCAGGCTTCCTTGTTTATCATTTT
GGAGTATATGGAGAACGGATCGCTCGCCCAATTCATCAAAAAGTTTGGGAACTTGTCCGAGACGCTAGTGGCCATGTACATCACCCAAGTTTTGCGTGGA
TTGGCGTATCTCCACGAGCAAGGCGTTCTCCATCGCGATGTCAAAGGCGCCAATATACTCACAACCAAAGATGGACTGGTCAAACTCGCCGATTTTGGAG
TCGCTGTCAAGCTGAATGAGACTCAAAAGTCCAATTCCGTTGTTGGATCGCCATATTGGAGTGCGTAATGCTCCATTTCCAAGTCGATTCTCGCTAATTC
ACTCGATATTTTGCTCTGATAGTGGCACCCGAAGTCATTGAGATGTCTGGATGGTCCTTTGCTTCGGATATTTGGAGTGTAGGATGCACCATCATTGAGC
TTCTCACCACCAAACCGCCGTATTTCGACTTGGCGCCCATGGCCGCGCTCTTCCGCATCGTTCAGGACGATCATCCTCCGCTCCCTGAACGTATTTCCCC
GGTACAAATCAAGCTATATCGCTCATATTCTGGTCTAATGTCTCTTCTAGGCGCTTCACGATTTCATAATGAAGTGTTTCATGAAGGAACCGCGTTTGAG
AGCCTCTGCCGAAGAGCTTCTCACACACCCTTGGATCGCTCAAATTCCCAAAAACAAAGTCGAACAGAGCTCTCAATTGGTTGTGGAGCATATCACATCG
CTTCTAGACCGAGATTCCATGCTCAACACCATCAAATTGTACGAGAAAGACAAGCAAATCGATAAACTTGCGCCCAAAGAAATGGACCAAAATGAACAAC
TATCAAACGCAAGCTCCGAAGGCGAAGATTGGGATCATGAATTCGAAGAGAAAGAGACGGAAGTCGAGCTCAAAGATGTTGGGAAAAGCAAAGTGGAGCT
CTCTCCTCGTCCATTTCAACTCAGCTCAGAAGACGCAAAAGCGCTGTTTGAAGATGAACATTGGAACGATTCCGTGCGGATCGAATCTCGACAAGTCTCT
GACCTTGGAATGACGCGATCCACACTCCACCAGCACCTGTCTCCATCCAGCGAGCAGCTCCAAATGCACTCGGCGTGGGGGGATCCGTGCATTTTACCAT
TGGAAGTGCGAAGTAAATTGGATTCCTTTTGCGAAATGGAAGACGATGAGATCTTTGGCGACATTGACGAACAGGAATTACTCCAAGCAGCACAGACAAA
GCTGAAATCGGTGCTCAAGGAAGACATGGCATCCTCAGGCAAGTCCTTTTCCTACTTGTGGAACGTGCTGTTACCTTTTTGTAGTCGAACGTCTGGCAGA
AACCTCGCCGAATGAAAGCCTTCCGACGCCATTGAGTCTTCGCGATACGTTTTTCGACACGGAAATGGACTTTGAATACACCACCACACGCGATAGCAAT
CAGCAAGTAACGAATCGCGTCATTGAGCTTCTTGCGTGTCTCGATCCCAGCATGGAGGACGCAATCATCCTGAGAGCCTGCGAGGATCTGGTACAATGTC
CATCCTTTCTGTCCTCTCCATACTCACTTTTGCTGTAGCGAGACATTCTTCAGTCTCATCCCGCGCTCTTTAGCGATCTCATGCTGCACGCTGGCATCAT
TCCCAACATCATGGAAGCCCTGGAATTCAAGAATCTAGACGTCCTCTACGCATTCCTCCAAGTGATCAATCTCGTGCGTTCCTTTTTCCGCTTTTCCACG
AGCTTTTTCACGAGCTTTTTGTGGCAGATAACCGAGAACAATCAAAAGTTTCAAGAGAATCTCGCGCTTGTGGGCTTCATTCCAGTGATCATCAAGCTCA
CACAAGCCCGACAGCTCGAGTATCTTCACTTTCTCGGCGTCGAGGAAGCGGAATCTCGCAGTTCGGCCGCTTCTTTGGACACTTTTACGCCCAATTACAC
CAATTTGATCCGTTTGGAAGCCGCCAAATTCGTCCAGAAAAGCTGTCGCACAAGTATTCTGACACTTCAAATGTTTATAGCCTGCGGAGGTCTTCCGGTC
CTGGTCGATTTCCTGGCTGCAGATCATCCTCGAGCTGTATCCTCAGACCAAAACGAATTGTGTCGCGTGGCAATGGAAGGGATCGAATCGGTCTTCACGC
TCCAAACTATTCCCAAGAACGATATTTGTCGACTTTTTGTCAAAGCCAATCTCTTAAGCAAATTCATCGCAGTCTTTGACCAAATTGTCGCCAGTGTCCA
CCGCGAATTCACTGAAGTTGGAGTGGAAGCCTGGACCATGGACGACCTCATGCGCACATGTGACATCCTCCTTCTCTTCTCGCAAGGCGATTCTATTGTC
AAGGAATATATGTGCGATCGGAATGTACTCAATGGAATGCTGAAAGCCCTGGTATGCCCGAACGTAATGGAATGTCTCCAGCGTCATCAGATGCACAAAC
GCGCGGATCGATACGTCTCCATCATCATCAAGCTCCTCAAATGTCTCCGGAATCTCAGCATGGAGCCTTCCACGCTGGAACATCTCGACCAAGCTGGCGC
TATCCAGACCCTGGTGTTCCTACTATCGCATGATGCACTCGGATCGCGACGTAAAGAGGTCGAGAATGTGATTCTACAGTCCATGTTTTACCTCTGCCGA
ATCAATCGCAAACGACAGACACATGCGGCACAGGCTGGTGTCATTCCATCGTTGGCCAAAGTGATCAAGGAAGGCTCCCCACTGAAACAATTCGCACTAC
CGATTCTCTGCGACCTCATTTACGCGTCACCGACCGCGAGGAATCATTTATGGGTGCACAATTGTGTCAGTCTCTTTCTCAATTTGCTGGAAGATACCTA
TTGGCACATGGATGCCATCAAAGCGCTGAGTGTGTGGCTCGTGCACGATACATTGCAAATGGAAAACGTTCTTCTGCTTCCGATACACTTCTCCAAGCTC
CTCCAAGCGTTCCACCGCGCACAGGATGCTGAAATGGACAAGCTTTTAGAGCCGCTTTTGGAAATTATGACACGATCGGTGCGTCTGAATCAAGCGTTTG
GACGAAGCGGATTGTTTGTGATGGAAGCGCTGGATCGGCTCCATTTAGCGCCCAAAGCGATTGTGAAGAAGCATCTTATCCGAATGATCCAAGTCTTATT
CGAATCGCATTCAGCCCCGCTGCATTTTGTCGTGGAATACAACTTGTACCCGATCGTATTCGCGCTGGCCCAAGACGCGAATAACCTCATTCTGGTCAAG
GAGATTGCGTCTCAGCTGCTGGAAGCCATTCTATTGACCGCGGCTATGGTTGGCGCTTGA