Transcript Name :
Pytar_ATCC12531maker-par_contig_1553-fgenesh-gene-0.0
Orientation:
(+)
Number of Exons:
3
Description :
U3 snoRNP-associated protein Utp7
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain11.207PS50294
WD40 repeat10.809PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat400SM00320
WD40 repeat81SM00320
WD40 repeat110SM00320
WD40 repeat1SM00320
BING4, C-terminal domain2.9SM01033
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
BING4, C-terminal domainIPR012952
*** None ***
InsideOutsideTMhelix
1-554
*** None ***
PositionContextScore
76LKGRLER|SG0.519
TypeScore
nuclear870
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1926 bases(100 bases per row)
ATGCCCTCAATTGAAGACCCTTCAAAAGAGACTTCTATTCAGGTAGTGAACAGTACCCAGAGGTATGTTGCCTCTTATGTTCCATTGGCCACGGTGCACC
ACCGCAGCCGCCGCCAAGAGCTCTTCGCCTCGACTCTCTCTCCCTCTCTGTGTAGCCATGACGTCCGACGACGAAGGATACAGCAGCAGCAGCAGCCNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGAGCCGGAGAACGTGGACGCGATCGTGCGCAGTGCTGCGACGCGGCTGGGCCAGAAGCGCAAGCCCGCGG
CGGCGCAGGACAAGCCGTCCAAGACCAAGAACGTCAAGAACCTCGACAAGTACACACGCCGCGCGCCCATCTCGCAGAAAAAGATCAAGGGCATCCGCGA
CAAGAAGCTCAAGGGCCGCCTTGAACGCTCCGGCTCCAAGTTCCAGGACGCAGCGATCTCGGCCGCCAAGTCCGAGATCTTGCTTCCGAGCCAAGCTGGG
TTGCTCGAGGCCGAGGGGCTCGAGAAGACGTACAACTTTACACAGGCGCAGCTCGCCGCCAACGTCGACCAGAACACTGCGCGCAAAATCTTCAGCCTGG
ACCTGCCCGACTACGGCGCCTACACCGTGCGGTACACGCGCAATGGACGGAACTTGGTGCTCGGTGGCCAAAAGGGCCACTTGGCGACCATGGATATGTT
GCGCATGCGGCTCTCGTGCGAGTTCCAGGCCAACGATCTCGTGCGCGACGTCTCGTACCTGCACAACAACTCGATGTTTGCCGCGGCCCAGAAGAAGTTT
GTCTACATTTACGACAGCTCGGGGGCCGAGGCCCACTGCCTGCGCTCGATTCCCGAGCCACGCAAGATGGAGTTTTTGCCGTACCACTTTTTGCTCGCGA
CCATCAGCGGTAATGGCTTTCTCAGCTACCACGACGTCACGACAGGCAACGAGGTCGCGGGCCACCGCACAAAGCTTGGCGTGTGCGACGCCATGGCGCA
GAACCCGTGGAACGCCGTGATCAACTTGGGCCACGCCAACGGACTCGTGACGCTCTGGACGCCCAATATGCACGAAGCCGTCGTCAAGATGCAGTGCCAC
CAGGGCCCCAGTACGTTTTGATCTCTTCCTGATCTCTTTGCTTTGGATCTAACTCACTCACTTTTGTGTAGTCCGCTCCATGGCCATTGACAATAGCGGC
AAGTACCTCGTGACGACCGGCGCGGACCGCAAGCTCAAGGTCTTTGACCTGCGCAAATACCAAGAGCTGAACGACTACTACCTGCACTCGGCGGCCAACG
CCATGAGCGTGAGTCAGCGTGGGCTCGTCGCCGTGGGCTTTGGGCCCAACGTCCATATTCTCAAGAACCCGTTCACAAGCCAGGCGCCGACGCCGTACAT
GACCCACCAGATCCCGGGCACGCAGGTGAGCTCGCTGGCGTTCCAGCCATTTGAAGACGTGCTCAGCATCGGCCACGCGTCGGGTATCGCCAACATTGTA
ATCCCGGGCGCCGGTGAGCCCAACTTCGACACGTTCGAGGCCAACCCGTACGAAAACGCCAAGCAGCGCGGCGAGACCGAGGTGCGGTCGCTGCTGGAGA
AGCTGCGCCCCGAGATGATCATGCTGGACCCTCGCGCCATTGGCCGCGTGGACCTCGACCCGGCCACGGAGCAGCTCACCAAGATCCAGCAAATGGAAAA
AGCCAACGGCAAGCCGCTCATCACCAAGAAGAAGATGCGCGGGCGCAACCGCCCGTCCCGTCGCCTTCGCAAGAAGCAGCAAAACGTCGTGGATCTGCAA
AAGGAAAAGTACAAGGACATGCTGGAGAACGCCAAGAAGAGAGAGGAGCGGCGCCAGCAGCAGGTCGAGTGGGAAGCCAAGGCGCAGAGTGCACCAACGG
CTCTGAACCGGTTCTTCAAGAAATGA