Transcript Name :
Pytar_ATCC12531maker-par_contig_1432-snap-gene-0.2
Orientation:
(+)
Number of Exons:
6
Description :
Tyrosine aminotransferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ankyrin repeat1PR00753
Ankyrin repeat1PR00753
Ankyrin repeat1PR00753
Ankyrin repeat1PR00753
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-433
NN-scoreoddsWeighted Score
0.5961.1140.002
*** None ***
TypeScore
cytoplasmic435
GO
*** None ***
KO ID
K00815
K00815
K00815
K00815
K00815
K00815
K00815
K00815
K00815
*** None ***
Sequence
        1670 bases(100 bases per row)
ATGACGACCCGTACGAGCACCGACGCCGGTATCACTGAAGATGTGCGCCAGCTCAAGATCCAGAAGGTCTGGAACGTCGTGCCGTCCGAGTTCTCCATGC
TCACGGCGAACCCGATCCGCAAGATCGTCGACAACATCAAGAAGCCGCAGAACACCGACAAGGCGCTCATCCCGCTCTCGCTCGGTACGCGAAAACGTCA
ATGTGAAGCTGGTGTTTTCGTTCCTTGGTGATGCTCACTGTCGACTAATTCATGTAGGCGATCCCACCGTGTTTGGCAACTTCAAGTGCCCGGATGTCCT
CGTCGAGTCGATTGTGCGCAACGTCCGGTACGTGTGGTGAAATGCGAGAGAAGTCATGGAGAGAAGATCGTCATGTCTGACCTGTCACGTTTCCCTCACA
GCTCGATGAAGCACAACGGATACATTCACTCGGCTGGCACTGAAGAGGCTCGTGACGCCATCGCGCAGGCGTACGGCAGCCCTGACGCTCCCCTCACCAA
GGATGTACGGCGTGTATGCTGTAGTTAATCTATGTGCACCATAGAAGGCTCATCTATCTCGTGTGTTTGTGGCTTTGCAGGATATCGTGATCGCCAGTGG
CTGCTCTGGTGCTATCGACATTGCCCTCACTGGCCTGCTGGACCCAGGAGACAACATCTTGCTGCCGAAGCCGGCGTTCCCGTTGTATCAGGTGATCTGC
GACGCCCACAAGATCCAAGTCAAGTTCTACAACCTGCTCCCAGAGAAGAACTGGGAAGCGGACCTTGCTCACCTGGAGAGCCTTGTCGACGAGAACACCA
AGGCGATCCTCGTGAACAACCCGTCGAACCCGTGTGGAAGCGTCTATTCGAAGGAGCATTTGCAGCAGATCCTCGCGGTCGCCGATCACCACAAGTTGCC
CGTCATCGCTGACGAGATCTATGGCGACATGGTCTTTGGCAACAACATGTTCTTCCCCATGGCGACGCTCACAAAGACCGTCCCAGTCATCTCGGTCGGT
GGTCTGGCCAAGAAGTTCCTCATTCCCGGTTGGCGCGTGGGCTGGCTCATGGTGCATGACCGCAACAACACCCTGAAGGACGTTCGCACTGCGTACTTCA
AGTTGTCGCAGTTGATTCTTGGGGCAAGCTCGCTCGTGATGGTGCGTCCGCCTGTTTGTGGATGAATGTCGTCAAATGTGTTGGTGCTCACATGCCACTC
TTCATTATGTAGAGCGCGGTTCCGGACCTTCTCACACCGACACCGGGCAGTGCCGAAGAGGCGTCGCTCGAAGAGTTCAAGCTCAACTACTACGACACGC
TCGAGCGGAACTCGAAGTTCACGACCGACGCCCTGAGCAAAATCCCTGGCCTGAAGGTCGTTGTGCCGCAAGGCGCCATGTACGTCATGGTCGAAGTGGA
CACAACTGTTCTCACCGGCATCAAGGACGACTTCGACTTCACCCAGAAGCTCCTCGATGAAGAATCCGTGTTTGTGCTTCCAGGCCAGGTATGTAACCAC
CTTCAACTTCCATATGTGCAGATATGGTCCATTTGCTAATGTATTTTGTGCATCCATCTCAGTGCTTTGGTATGGAGAACTACTTCCGCATCGTCTTCTC
TGCGCCGCACGAAGTGCTCGACGATGCCTACACACGCATCGCCGAGTTCTGCAAACGCCACAGCCAGTAG