Transcript Name :
Pytar_ATCC12531maker-par_contig_874-fgenesh-gene-0.1
Orientation:
(+)
Number of Exons:
1
Description :
Kinesin heavy chain
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Kinesin, motor domain2.9PR00380
Kinesin, motor domain2.9PR00380
Kinesin, motor domain2.9PR00380
Kinesin, motor domain2.9PR00380
Profile scan predictionP-Valprediction_id
Kinesin, motor domain55.212PS50067
Zinc finger, ZZ-type12.928PS50135
HmmSmart predictionP-Valprediction_id
Kinesin, motor domain5.8SM00129
Zinc finger, ZZ-type2SM00291
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1204
NN-scoreoddsWeighted Score
0.5911.9290.004
PositionContextScore
609RSVRGGR|SA0.67
846TTGRLDR|FV0.551
884SSARSSR|GS0.576
TypeScore
nuclear696
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
zinc ion bindingGO:0008270IEA
microtubule bindingGO:0008017IEA
microtubule motor activityGO:0003777IEA
microtubule-based movementGO:0007018IEA
KO ID
K10396
*** None ***
Sequence
        3615 bases(100 bases per row)
ATGGCCAGTGCCAAGCCCGCGCCCGCGGGGGTCCGCGTCTGCGCGCGGTTCCGCCCGCAAAACAAGCTCGAGCTCAAGCAGCAGGCCGTCGAAGTCGTCC
AGATCGAGGACGACACGACCGTGCGCGTCGGCAATGGCGCCGGCAGCTTTGACAGTGCGCACACGTTCACGTTCGACCGCGTCTTTGGCATGGACTCGAC
GCAGGCCGACGTGTACGCCGCGACCGCGCAGCCGCTCGTGCAGGCCGCGCTCCAAGGGTACAACTGCACGTGCTTTGTGTACGGCCAGACGGGCACGGGC
AAGACCTTTTCCATGGAGGGCGTCCCCGGCGACAGGGACTATGCCGGTATCATCCCGCGCGTCATGGACGACATTTTTGACGGCATCGACAACATGCAGG
CCGAGCTCGAGTTCATTGTGCGCGTGTCGTACATTGAAATCTACTTGGAGAAGATCCGCGACCTGCTCAAGCCGTCGTCCAATAATCTCAGTGTGCGCGA
GAGCAAAGACCGTGGCGTGTGGGTCGCCGGCGCGACTGAAGTGTGCTGTGCGTCCGCGGACGAGATGATGGCGGTCATGCGACTCGGCGGCGCCAACCGC
GTGATCTCGTCGACACGCATGAATAACGACTCGTCGCGGAGCCACTCGGTGTTTATCATCACGGTCGAACAGCGCAACGTCTCGACGGGCTCGACGAAGA
GTGGTAAGCTCTTTCTAGTGGACTTGGCCGGCTCTGAAAAAGTCGGCAAGACCCAGGCCAAGGGACAGACGCTCAAGGAGGCGCAACACATTAATAAGAG
TTTGAGCGCTTTGGGCAGCGTCATGAACGCGCTGACGAGCGGCCAGGCCAATGCCCACATCCCTTACCGCGATTCCAAGCTCACGCGGTTGCTTCAAGAT
TCGCTGGGCGGCAACTCGGACACGACGCTGCTCGTGTGCGGCAGTTGTAGCAGCTATAACGCCGAAGAGACATTGACAACGCTGCGGTTTGGCCAGCGCG
CCAAGAGTATCAAGAACAAACCCAAGGTCAATGAAGAGCGCACGGTCGCCGAGTACAAGCAACTACTCATGGAGAAGGAGCAAGTCATCGCAGCGCTCCA
GGCGCAGATTCAGAAGATGGCCGACTCGCCCTCAACGAACGAATCAACGGTAGGCAATCCTGAGGGAGGTAGCGAGACCCAGGTGCAGACGATTCCAGAG
CTGCTTGCAAAACTCGAGCAGCTAGAAGATGAGCAAGTGTCCAAGGTGTCGGAGATTTCGAGTCTGGAAGAGCGCGTCGCCGAGCTCGAGTCACGGCAGC
ACGAGTGGCAAAGCAAAGAAGTTGAGTTCACGAAAATGGACCAGCGTACCGACGAACTGACCAGCCAAGTCGCCTTTCTGGAAACCGAACTCAAGGCTAA
GGTCACGGAATGCGAGCAGTTGCAGGCGCTGTTGCAAACGCAAGACACTCTCCCACTCGACGATAGTGCTGCCAAAGCGCGCCACCGGTTCAGTGATGCC
GACGCAATGAAGCCCCAACCGGTGGGAACGCTGCCCGCGAGTCGAGGCACACAGATCGAGAAGGAGCTGCTTCGCCAGCAGCTCGGTGCCAAGTCTGCTG
AGCTGTCGATCTGCACGGCGCGCATGCAGGCGCTCGCTGAGGAATTGACCAACTGCCGGGGCTTTTACGAGCGCCAGATTGGATTGCTCGAGGAAAAGCT
GCACGAGTACGAGTCCCACGTCGTGGGATTCATGGCACTCGCCGAGAGCGACGACACGAAGCCTTCGGCCCAACTGGACTCACTATTGCAAAAGAGCAAG
ACGCTTCGCTCGGTGCGTGGCGGACGCTCAGCAACCACACAGGGCGTCACTCCCACCAAGGAACTGAAGGAGGCCCTGGCCGCAGCGGCGCCGTCGTCTC
ACGGGGCCAAGGCGAACGGCGACATCACGACCGAGCAGGAACACCACCGGCCTCGACTAGTCAGCGCAGCCTCGACCGATGGCTGGGCGATCGACGACGA
AGTGTTCCCCATGGCACCAATCGACATGGACTCGCCCATCGTGCAGCGGCTCATTGCGAGTATGCCCGAAAAGGGACGTGAGAAAGTGTACAAGTGGCTC
GTGTTCGTACTCGAAGGCCGTGACATCCGGTCTAATTTCCACCCCGAGCTTTCCTTGGAAGGCATCAACGACGAGATCAGCCGTGACATGCGGCGGCTCA
TCATCCCACTACTCAAGAAGCGCCAAGACATTGCCGTCGAGTCGTACGTGCGCACGCGATTTGTCAAGGTCTCGGACCTCAAGATCAAGCTCGTCCACCG
CCACCGTGACATCATGCACTTGGCGCCGACCGTGCGTGACGAGACGCCTTTGGACGGCGACGCCGACAGCTTGGAGAATGGAGCTGCGCGCCCGCCGCGG
CGGTCGTCTGCTCCTACTCGTGATCTGGGCAAGATGTGGGCCAAGGGCCACTTGTTCTACGGTCCGAAAAGTGACCCCGCGAGCGAGTCGGTGCTCCACG
TGCAGCGCACACCGGCGACGACCGGACGGCTTGACCGGTTCGTGTCGGAACCGGTCGACATGAGCGCGACCATTCTGGAATCCAAGACCATTCTCGCTTC
GGGAAAGGCTGGTAGTGGTGGGCCACCGAGCTCGTCGGCTCGCTCGTCTAGAGGATCCTCCATGAGCAAGGAAACCGCCACCACCACGACAGCGCCAAGC
TCAACGTCCAAAGAAGGCAGCGGTCTTGGTGGCATGTTTAGCCGCCTCCGTGCCCACCAGGCCAGCGTCTTGGGCGACGTCAAGACGGCGCTGACGGCGC
GGTACAACAAGCACCACGTCCATGAGGACACGATGTGCGACGGCTGCGGCGTGAGCCCGATCGTTGGTGCCAAGTGGACGTGCAACACGTGCGAGAACTA
CGAGCTCTGCGATACGTGCTATGGGCTGGGCATGCACGGCGGCGAGATCAGCCTCGAAATGTGTCGACGCGTCGAGCAGGTCGCGACGCAAAAGCACCGC
GTGTTGGCGCAGTTTCCCGAACTCTTTGAGCTGTTGCGCAACCACATTTGCAGCGACGACGTGATCCATTTCCGCCAGATCGTTGACTGGCTGTGTGACA
TTGTGGGCGGCAAACCCGTGGCCCAGCTGCGGCAGCGCAGTATCGTCAAGAGCGGACTCCACCCCGAGATCCGTGCGCGGCTAGTTGCGCAGCTCGGCGC
GATCGCGAGCGAGCGCACGGACCTCGAACTCAAGACGGAGTGGTTTGTGCCAGCCGACGAGGAAGAAGACGAGCAGGAAGAAGACGGAGAAGACACGGAG
AACGACACCCAGTCGTCCAAGAGCGGTGGCCCGCGCAGCGACGACGGCGCCAAAGAGACGGAGCCAGCAGTCGAGACTGGACACAGTACACCGCTCGAGA
CACTGCGCATGTATGTGGTCAACGTCGGGTCGTCGACAGAAGCTGCAACTGCACCTGCATCGTCGGGATTACTGCCGCCGCTGTCGGTGCGAAAACTGAG
TGATCGCTATTTCGCGAGCGTGACCTCTTCAGACGACGGCGGCAACCACTCGGTCGTGTCTGGCTCGAGTCGCAGCGACAGCGTCGCGACTGCAGAAGGA
GCCTCCCGTTCATAG