Transcript Name :
Pytar_ATCC12531maker-par_contig_792-snap-gene-0.4
Orientation:
(-)
Number of Exons:
4
Description :
Gallus gallus hypothetical LOC424466 (LOC424466), mRNA.
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Dual specificity phosphatase, subgroup, catalytic domain17.134PS50054
Protein-tyrosine/Dual specificity phosphatase15.693PS50056
HmmSmart predictionP-Valprediction_id
Dual specificity phosphatase, subgroup, catalytic domain2.6SM00195
Protein-tyrosine phosphatase, catalytic0.0016SM00404
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Protein-tyrosine phosphatase, catalyticIPR003595
*** None ***
InsideOutsideTMhelix
1-459
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein tyrosine/serine/threonine phosphatase activityGO:0008138IEA
phosphatase activityGO:0016791IEA
protein dephosphorylationGO:0006470IEA
*** None ***
*** None ***
Sequence
        1523 bases(100 bases per row)
ATGAGCCAGCCATGTACCGCCGTCATCTCGGACCCGCTCGCTCGACGCGAGGTGCAAGCAACGCTCTACGATCGCGTGTGCATAGTTCCCGGCGGCCTGG
ACTACGCGTTGATCCCCTCCGCATCCTACGGCCGCACATCTCCAGCTGCTCCGTCGTCGCCGACCGTCAAAGAGGCACGGGGCGACGAGGAGGAACCGGA
AACAGAGTACTTCACTATCGATGAGCAGCTCGTATATGCTCGTTTCTTTGCCGACTTCGGCCCGCTCGATCTCGGCCAAACTATCCGATTCTGTCGTGCG
ATGAAAGATCTCATCGCCAAGACTAGCAAAGTGCTCCTGCTCAGCAGCGACCACCCTCACAAGCGAGCCAACGCGATGGCGCTGCTCACTCTCTATCTCG
TGATAGTTCACAAGCAAACGCCACGAGAAGCGATCGCTCCGTTCCGATCTCTCCGCCCCGCCCAGGGCTTCCGGGATGCCGCCTGCGGATTGTGCTCGTA
CTTCATCACGGTCTTTGACTGTGCATGTGCCGTCTACAAGGTCGGTGTTACGATCGTTCGTGGTCTGTGAGAGTACGCGTACCATGGACTAATCCGCTCG
CCTGTATTCGTAGAGCAGGCGATGCGCGCATCAATTTTCGATTGCGAGACTTTCCGCCTTGACGAATATGAGCACTACGACAAGCTCCATTATGGTGATA
TCAACTGGATAGTACCCGGCAAGCTGCTCGCGTTCAGTGGCCCGCAACGTGAGCGAGTGATTCTGGATGGGAACGGCCGGACGACGCTGCTTGCCCACGA
ATACGCCAAGCTCTTTACGACGCTGGGCGTGGGGTGCGTCGTGCGGTTCAACGAACCGACGACGTACGATCGGCGCGCTTTCACCCACGCCAACATTCGC
CATGTACGTGGTTCTTCCGCTGACTTCATACTATGGTCTCTGACGAATCATGATGGAAATGGCCAGCTCGATATGCACTATCCCGATGGCGGGAACCCGA
CCGACGAGATCCTCTTCAAGTTTATTCGCGTGAGTCGCACGAGGAACCTTTTTAGTTGTCCACGTGTATTGCTGACCACGATGTCGCTTGGGACCGGTAG
GTATGTGAGCGCGAGTCGGGAGCGGTAGCAGTCCACTGCAAGGCCGGACTGGGGCGTACGGGCACGAGTATCGCCGCGTACCTTATGAAGAAGTATCGAT
TCTCGGCCCGTGAGGCCATCGCGTGGTGTCGAATCTGTCGTCCAGGAAGCATTGTCGGTCCACAGCAGCAATTCCTCGTGGTCAAGCAGCCGCAGCTGTG
GACATTGGAGAAAGAAGAAGACGAACAACGGCGGCAGCAACCAACGAAGGCAGAAAGCACAAGTGGTGGTCCCGTGATGGTCAAGCGGCAGTCGTTTGCT
GCCGTGCGGGAACGGCTACCCAAGGTGAGTGGAGGGATCATGCCCGTGATGCAATCCCTCCGTCCGGGCGCGTCGATTCCTTCCAGTTGCAGTCTAGTCG
TGGCGAACATAGCGTCGAGCTAA