Transcript Name :
Pytar_ATCC12531maker-par_contig_785-snap-gene-0.5
Orientation:
(+)
Number of Exons:
6
Description :
Cytosol aminopeptidase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Leucine aminopeptidase/peptidase B1.9PR00481
Leucine aminopeptidase/peptidase B1.9PR00481
Leucine aminopeptidase/peptidase B1.9PR00481
Leucine aminopeptidase/peptidase B1.9PR00481
Leucine aminopeptidase/peptidase B1.9PR00481
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-608
NN-scoreoddsWeighted Score
0.5811.3930.003
PositionContextScore
128STARAKR|AK0.702
TypeScore
mitochondrial739
GO
Biological ProcessGO IDPrediction Method
aminopeptidase activityGO:0004177IEA
metalloexopeptidase activityGO:0008235IEA
cytoplasmGO:0005737IEA
protein metabolic processGO:0019538IEA
KO ID
K01255
*** None ***
Sequence
        2398 bases(100 bases per row)
ATGAAGCTCTTCGCGCGCCGGCTCTTCAGCAGCGCCAGCGGCGTCTCAGCGCACCGCCTCGTGGCGCAACGCGTACAGGGAAGTCTGTCCCTTGCACCAC
AGTCCGCTGCCGCCAACACGCGTGTCGTATTCGTCACCAAGGAGCAGCGTGACGGTGGCGACGCCGCGCTCGCCCAGGCGCTGCCCTTTGCCGTCTCGCC
ACACGCGCTGCGCGAGTTCAAGGCCAAGCCGCAGGAGAAACTGTACTTATACCCAAGCAGCGACGATGCGTCCCTCGCGGACCAGCGCGTCGTGCTCGTG
GGCCTCGGGGAAGAGAAGAAAGTGGATGAAAACGTGCTCCGCAATGCGACCCACGGCGCCATCTCCACGGCGCGTGCCAAGCGCGCAAAAGACGTCGTCG
TGCAGCTGCCAGCGCTTGCCGCCGACCATGAGAAACTCACGCCCACACGCGTGGTCGAAGTACTCACACAGGCGTCGATGCTTTCGAACTACCAGTTCGA
CAAGTACCTGAGCAACGAGAAGGATGACAATGGAGAGCCAAAGCTCAAGCTGCCGCTCGAACAGATCTTCCTGGACGCGAGCGTCGAGTTCCAGCAGGTG
CGAAACCAACACTGCATTCTATAGTAGGACAGGAACGCTCACCCTCGATTGTGCTCTGTGAAACAGCACGTCGAGGAGCAGATCACAGTAGCCGAGGAGA
CCATCTTTGCCCGCAACCTTGGTACGTCTGCTCTCTCTCCCACCGCTCGCACTGCGTTGCGGCCCTCTTCTCACTGTGAATCTCCATTACCAAACGTTAG
GAAATGAGCGCTCGAACGTCGTGACGCCGGCATTCATGGAAGAGGTCGCTCGCTCGTCGCTCGAGCTGCCCAACATGTCCATCTCGGTGCTCCAGCAAGA
GGACCTGGAGAAGCACGGCATGAACATGTTTCTCGCCGTGGGCCAAGCAGCGGCCGTTCCTCCACGGCTCGTGATTCTCGAGTACAAGGGAAACCCCGAG
GCACCGGACGACAAGATCGCGCTCGTAGGCAAAGGCATCACGTTTGACACGGGCGGGCTCAACCTCAAGCCCACAGGTTTCATCGAAGACATGCACACGG
ATATGTGCGGCTCGGCAGCCGTCCTTGGCGCCGTGCGAGCGGCCGCACGTCGTAACCTCAAGGTTAACATTGTGTGTGCACTCGCGCTCGCCGAGAACGC
CATTGGCTCGCAGGCTACCAAGCCCCACACCATCATGAAGTCCCACAAGGGAATCACCGTGGAGAACAACAATACGGACGCCGAAGGACGCCTCGTGCTG
GGCGATGCGCTGTCGTACGTGCAGCAAACGTATAAACCAAAGACGGCCATTGACGTGGCGACGCTCACGGGCGCTTGCATCGGTACGGCCCTCTCTCTTT
CTCTGTGGATTTTTTCCACTGCGATCACTGACTGGATCTTGATGTGTGTCTTTACTTTTGCCAGTCGCGCTGGGTGAGCACTGCGCCGGTCTTTTTTCCA
ACTCGGACGACCTTGCCGCTAAGCTCCTCGTGCGTTCTCCAACTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCTGCCTGAGCACAC
GGAGGCACTCAAGGGCACACAGTCGGACTCGCGCAGCACGAGCAAGGGCCGCTACGGCGGCGCCANNNNNNNNNNNNNNNNNNNNNNATTGCCGGTCCGT
CCAACTACAGTGCCGCCAAGTCGTACTTTCCCGCCGGCGCGACGGGCTTTGGTGTGCAGTTGCTGTACAGCTACGTCAAGCACCACGAGGCCAAGCCGTA
ACTGAGATCTCATCCAGAGCATAAAAAGGCAAGCGCTAGAGTACTAGGCGGCGTATTTTAGGGGGTGTAGACATTCCACACGAATACACTGCCGTCGTCG
CCCACGGACACAAGTTGCCTGTCGTCCGGACTGAAGGCAAGGCTGCGCACGCTGCCCGAGTGGCCAACCCCGTCTATGAGCAGATCCCCCGTCAGGAAAT
CCCAGAGCTTGACGAGACGGTCATTGCCGCCCGTGGCAAACACCCCCAGCGAGTGGGCGACAGCGAGGCATGTGACCTCTTCGTCGCCGTGGGCTCGTTG
GATAACATTCACGGGCGCGTCGTCGATGCGCAAGTCCCAGAACGAGATACGCTTTTCCTGCCCGGCGCTGAGCACGAGCTGCTGGTCGCGAGAGAGCGCG
ACCGTGTTGAGGCCGCCCATGCGCTGCGTGTGGCTCGACACGCGGCGCTCATTGCGGAGATCCCAGCACAAGATACTTCGGTCGCGGCTGCACGATAG