Transcript Name :
Pytar_ATCC12531maker-par_contig_733-fgenesh-gene-0.1
Orientation:
(+)
Number of Exons:
3
Description :
Voltage-gated Ion Channel (VIC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-60
144-253
308-318
84-120
274-287
342-665
61-83
121-143
254-273
288-307
319-341
*** None ***
PositionContextScore
253LRNRPRR|WL0.695
*** None ***
GO
*** None ***
KO ID
K05325
*** None ***
Sequence
        2293 bases(100 bases per row)
ATGCCGGCCAAAAACGAGATCGTGCCCCTGGACGCCGGCCCGACGCGGCAGACCCTCGCCGCCCCAGCGCCCGTCGTGTCGGCACCCGCGAAGCCGTCGT
CGAAATCCGACTTGAACTCTGACGCGCTCAACGCACAGGAGCGGCGGATACGGCTCGTCGCGGCGCAGAGGCGCCACACGGCGTTCCAGCTCTTCTTTGC
GCTCTTCGGCGTCGCGCTCATGGTCGTGCAGATGGAGTACCTGTGGTATGCCAACACGCAAGACTTTGCGGGCGTCTGTGCCATCGACCCGGCCACGCAC
TGCCCCGCGTGCCTCGCGTCGCTGCCGCACGCCGTACCTGTACCGGGCGGCCGCATGATGCTCCACGCCGTGCGCGTGCTCATTTCGTTTTCCACACTCA
TCCAGCTCTACTACATCCACGCCTTCTACGCGGCCGAGTGCGATGTGCTCAAGATCAAGAACATTGTGCCGCCCAAGGCCACACTGCTCTCGTCGCCGCT
GCGCAACCAGCTCGTGCTCGAGCTGCTGGTCTTTGCCGTGCACCCGTTCCCGGGGCTCGAGGCCATCGACCCGCAGTGGCCCAACCTCGTCGTGGCCTCG
AGCCTGCTCATGTTTCCGCGCTTCTTCCTGCTCTTTCGCATGCTTCAGTTCCGCGACGCCTTCAACTCGAGCAACGGCTGGTTCATCGGTGCGCTCACGA
ACGTGGACTTCACAGCCGCCTTCTTTCTCAAGGCCACACTGCGCAATCGACCACGGCGCTGGCTGCTCGCGAGCTTTGCGCTGCTGCTCGCGACGACGAG
TTACTCGCTGTTTGTGGTCGAGCGGTTCGTCTGCGCGTTCCGAGCCGACTCGTGCTGCCGCCCGATCGCCTTCACGGACGCTCTGTGGACGCTTGTGGTC
ACGATGCTCACGATTGGCTACGGCGACGTGGTGCCCCACACGTCGACCGGCCGGTTCCTCGCCGTGCTGGCCGGGATCTTTGGCATGGCGTTCACGGCCG
TGACGATCGCCGTCATGTCGACGTACTTGGTGCTCACGCGGTCCGAGCACAAGGTGAATGCGTTCATTAAAAAGGACGAGAACCGACGGCTCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNACCACGCGGCACGCGCGATCCAGGCGTACGTGCAGTGGCGCGCCGTGCAGCGGCGCCTGGAAGGAGAGCGAACGCG
TGGTGCCGTGTCGGCCCTGGCCAAGGCCGAGCAGAAGCTCTACGACGTGCTGCGCGTGTACCGCCAAGTCAAGCGGTTTGTCAACTCACACGACGTGAGC
GACCCCATGGACAAGCAAATGACCATGCTCGAGATGATGGAGGTCAACGTCGAGTACATTCGCACCAAGATTGAAGACCTGAACGATCTCTTCCACGCGC
AGGCCACCAAGCAGCACCTCGCGGCGAACAACAAGCGCAAGCTGCAGACGCCCACGGCCACTCCCACAACGGCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTACACCCGCTACGATGGGCGTCACGGGGACCAGCAAGCCAAAGTCCGAGGACGCGTCGTCCTTCACGACGACTGAGGAAGGGTCGTTCTCG
GGACAACGGGTATTGTCCGAGACGGAGACGACCACGGCTGTCGTGGCAGTCGCCGCTGAGCCAAGTGAAGCACCCACCCCAGGCGGTAAGAGCAGCCCGA
CCAATCTACCGCGGACTGGTGCCGTCCCGGGGCAGCCGATGAGCTACGACAGTGACAGCGACTCGCGATCGGTCGGAATGGACAGCAAGATGGGAGGAGG
CACAGGGAGCCAGTCGCCCGGCTCGAGCCGAGCCTTGAGTTTTGCCGGGCCGCAAAAGACTCCCAGCTCTTCCGAATGGGCGATCGCCATGGAGCAATCC
ATGCAAGCGATCCTGCTCCACGTCACGCGCGTCTCGAACGAAGTCGACACACTGCGGAGCCGCGTCGAAACGCAAATGGACCAGCTACAGGACCGCATGG
TCGAGCTCGAGAAGCGCTTGGGCGTGCAGGACGCGTTCCGCGAGGTCACACGCGGCGCGTCCGTCCGCAAGAACATTTCGCGGGCATTCTCGGGGCACTT
GGCCGACGCCTTGGACGGTCCCACGGCAGCAAATACCACGACTAGCGCAAGCAATACCAACGGCGCCGTGATGCTGGGCGGCAGTGTGCGGTTGAACCGC
ATGTCGTTCAAGCAGCAGCACCGGCCGTCGATCCACAACTTTGTGACGAGCAAGGATTTGGAAGAGTTCCACAACAGCGGCTCGATCGACTGA