Transcript Name :
Pytar_ATCC12531maker-par_contig_655-fgenesh-gene-0.1
Orientation:
(+)
Number of Exons:
8
Description :
Calcium-dependent protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain6.954PS50222
EF-hand domain10.05PS50222
EF-hand domain9.911PS50222
EF-hand domain13.091PS50222
HmmSmart predictionP-Valprediction_id
EF-hand domain8.4SM00054
EF-hand domain11SM00054
EF-hand domain1.2SM00054
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-603
*** None ***
PositionContextScore
254CMQRTGR|SA0.526
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        3896 bases(100 bases per row)
CTCCACCGGCTCGCGCAAGCGCGTGTTCACGTTCCAGAAGCGCTGGCTGCACACGCTGCCCATCATGGAAAAGGTGCTTCCAGACAGCGCATTGGATGCC
GCTAGCGTCGTGGCGTTGCGCGCCGCGAATCTGCTGGGTGAGGACGGCAAGCCCGTCGACGACGGCGGCGCGCGCGACGTGGTCGTGTGCATGCTCTGCG
ATGACCCGAGCGCGAGCCGCGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNCATTGAGAACCACTTGATGAGCAAGCACCCCGAGTTCATGTTGCTGCTCAAGCAAAAGCGCGAGACGGAAGGCGACCTCGCCGTGCAAATC
TTTCTGCAGAACATGCGCGAGGGTCGCTGCAACGTGCGCCATGAGATCAGCGCCGGGCTGTACAGTCACATGCAATCGGCGCCGAGCGCTGAGCTAGCCC
ACAAAAAGCGCGCGTTTGCGCACGACGAGTTCATGATGCCGACGGCAACGACCACCCCGGCAGTCTCGCTGTCCAAGCAATCTCAGCCGTCGCTCAGCGA
CGAGGCCGCATCCGAGACGGCATTGGAGGCTGAGGCCCGACGTAAGCGTCTCAAGACCAACGGCAACGCAGATGCGACAGCAACCACGTCTGCAGACGCT
GATGGCACNNNNNNNNNNGATGGCACCGCCGATCTGCTGGGCGTGTCGCTCTTGTCGTACCACGGGCCGGCGGCCTTTTCCCAGTGGAAGAATCTCATGG
TCAACAAAATGGTACGACGTGGAGGTTTCCATCCGATCTGTAGACGCAGCCAACTGACTGGTCGGTGCTTCTTGTGTCTGTAGATTGTTGTGACGGGTGG
AGAGATGCCGGCGATCGCACGAGTGGCCACCAACCTCTGGCTCGTCGGTGCCAATGTACTCGTGACGTTTGCGTACGTGAATGTATCCATTCCCCACCAC
CCATGGGTCTCTCAAGTGAACGCTCTGCCAACACAGGGAGCAAGCCCCGATGGAGTCGTTCGCGGCCAGCTACCTCACGCAATTCCACGCGGCCGGCAGC
ATGGAGCCGCCGCGCGGCATCATGCTGCCACTCTATTGCTCGCTACGGTCGCGGCCCGAGATTGAAGAGTGGAGTCGGTCGATCGCGTCCAAGTTTGGTC
AAGTGGATTTCCTGCTCAACTTTGTCCACAACGATGTGTCCCGTGAGAACCCCGTCTCAGTCAATGCGTACGTTCTTGTCGGCCGTGGGGTCGGATTCGA
ACTGCAGCCTGTAGTAAGCCTGTTTGTCTCGTGTCTGGTTGATTGACATAGGAATCGGTGCAGAGAACTCTGTGAAGTCTTCAGTGGCGCGTGCATGCAG
CGCACCGGCCGAAGCGCGATCATTAATATGGCCTGCGAGGCGGAGTGTGGGTACGTCCTGCCGCATACCATGCTTCACTCCTGTCAGAATACTGACTGTA
TTCATAAATGCAGGCAAGAGAGTGACGATACGTGTGCGGCCGTCGAGGCCCTGACCAAGTCCATGTCCCTGCAGCTGCGGGCGCTCAACGTCCAAGTCAA
TGCGCTCGTTCTCCAGAAGCCCGACACGGTGCCTATCGCCGCGGGGGATGAGGACATTGAACTCATTCACTTGATTCTCTTTCTTCTCTCTCCGGCGAGC
ACGTGCGTCAGCGGCAGTGTGCTTTGCCACCGAAAATCAGTCCCGGTTTCAGCCGCTCGCGCGACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAACGCCACCACGACCACCAACGCCGTTGAAGTCGAGACGCA
CGTGATCTGAGCGGGACAATCGATCTGTAGCCATTTGCGATAGTACTGTATGAAGTAATATTATACATCCCTGGGGTACAAAACCTAGCTCAAGTCGCAC
GTTGCGCCCGTCAGTCAGTTTCCCCAGCGGCTCAGCTCATAACGCCCCTCACCACCAGCGCAATGCGCGTCAGTGTCTCGATGCGTGTGTCTCGCACGCT
CACAGCGAGCAACAAGCGACCGCGATCCTCCCCACTGTGCTCCACAGCACGCAGACTCCACACGGAGCTGCAGCGCGCCATCACTCCCCAGTCGCCACCA
CCACTGGACACTGAATCTCCACCGGTGACACCCTCGCCATCATTCAGTCGCGTCTCCAATGCGCCGTCCGTGAGCGCCGCTCGCCTCGCACACTTCGGCA
GCGTGCGTCGTGCGTGGCGTCCTCTGCTCGCCAAGCTCGGCGCCGTGCCTCGCCTCCAAAAGCTCGCCTTGGAGACGGCGTCGTTCTTCACGACGCCGCA
GGAAATCGACTTCCACTTGCCACGCGACTTTGCAGCCAAGTACGAGCTCGCCGAGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGAGGGCGCCTTCGGCCGCGTCCATCGCGTCGTTCCCCACATGGACTCGCACACGGCGCTGGACCTCGCGGTCAAGATCATCCCCAAGGT
CCGCGTCGTGAACCTCGCCGACTACCAGGCGCTCCAGCAGGAAGGCCGCATGATGGTGCTGCTGGGTGGCACGCTCAACGTCGTGCACTTCTTTGGCGCG
TACGAAGACGATGACAACGTATATCTCGTGATGGAACACTGCGTGGGCGGTGATGCGTTCGCCCGGCTCACGGGGGCGTCCTCGAGCGAGTCGCAAGCGG
CCTCGTACATGGCCGACATTCTCCACGTCGTGCACCAGTGCCACTTGCTGCGCATCCTCCACGGCGACCTCAAGCTCGAGAATTTCCTGTTCGCCGACAC
GAGCGACAACTCGCCGCTCAAGCTCACGGATTTTGGTGGCGCCTCGTTTCTAGGAGAAGACGAAGTGCTCCACGACGTGCGCGGCACGCCACTGTACACG
GCCCCCGAAGTGCTGTCGAAATCCAAACACGGGTACGCGTTCCCGTCCGATATGTGGAGCTGCGGCGTGATTCTCTATCGCCTGCTGGCCGGACGCTTCC
CGTTTGACGGCGAGCTGCTGGACGAGCGGATCCTGTTGGAGGAGCTCGATCTCACGTCGCCGCCGTGGTCGCACATTTCGTCGCAGGCCAAAGATCTCGT
TGCCAAGCTGCTCACGCGCGACGTTGGGGCACGACTCACGGCCCAGCAGGCATTGCAGCACCCGTGGATCGCACGTCCCCTCACGAATGTCTCCCCAACG
CCACGCGTACTGGACGGCACGCTCGTGCAGCGCCTGCAGCTCTACCGTTCGCTCAACAGCTTTCAGCAGGCCGCGTTCACCGAGATCGCGCGGCGGCTGC
CGCTCGAAACCAAAGAAGAAGTGGTCGTCGTGTTCAGCGAACTGTCTCGCCACGGCTCGTCCAAAGTCGGCATTGCCGAGTTGACAGACTATATCGCCCG
CGCCGGGTACCGCCTCACGGATGGCGAGATGCGCAGCTTCCTGAGCCGCCTCGATCTGGACGGCGACGGGTTCCTGACGCTCGACGAGTTCTGTGCGTCG
CTACTGGACTGGTCCGTGATCCAGCGCGAGTCGCCCGCGCGCTGGGAGCAAGTGGTGACGCAGGTCTTTGACTCGCTGGACACTGACGGCGACGGACGAC
TCGGGCTCGAGGACCTGGCAGGGCTCGCGCCGTTTCAAACAGCACAGCGTGCCCACCACTCGTTCCGTGGGGACGTGCGCCGCTGCTTCCAGCACGCGGA
TCTTGATGGCGACGGCACGATCGACCGCCGCGAGTTTCTTGCCATGCTTCACATGCAATTGCGTGCCTACGAACACTTTGCGCAGCGGCTCCATTG