Transcript Name :
Pytar_ATCC12531maker-par_contig_518-snap-gene-0.5
Orientation:
(+)
Number of Exons:
5
Description :
ATP-binding Cassette (ABC) Superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
ABC transporter-like10.151PS50893
ABC transporter-like16.533PS50893
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain2.2SM00382
AAA+ ATPase domain9.7SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-87
192-207
268-273
368-774
927-948
1009-1020
1076-1133
111-168
231-244
292-347
798-903
972-985
1044-1057
1157-1706
88-110
169-191
208-230
245-267
274-291
348-367
775-797
904-926
949-971
986-1008
1021-1043
1058-1075
1134-1156
*** None ***
PositionContextScore
1685RSSRSSR|NS0.534
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
ATPase activityGO:0016887IEA
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        5539 bases(100 bases per row)
AGAAAGCTCCAGCGCAGCTCCTCATCCACGCCCACAGAGAGCGACAGTCTCGACGTCGCCAAGTCGCCCTCGTCTTCATCGCCTAGTCTACACGACCACG
CGCTCGCCAAGTGGGTGCGCCAAGTCGCTGTGCTCGTCTGGAAGAACCTCGTGCTGCGAGTACGGCGCCCCGTCGCGCTCTTATTCGAGCAGCTCGTGCC
ACTGCTCTTTGTCTCGGCGCTCGTCGTGCTCGNNNNNNNNNNCCCCTCATCTCCATCGCCTAGTCTTCAGGACTGCGCGCTCGCCAAGTGGCCACGCCAA
GTCGCCGTGCTCGTGTGGAAGAACCTCGTGCTGCAGGAACGTCGCACTCTTAGTCGAGCAGGTCGTGCCGCTGCTCTTAGTCTCGGCGCTCGTCGTGCTC
GCGAACCTCGACTCGCTCTTTGGCCGCGACGCCGACTCGGTCTACCGGTCGGGTCGCCACGCTGCGTCTCTGAACAGCACCCTCTTCTGCGTACAGCTCG
CGTCGCTCTCGGCCTCGGATCTCGGCGCACCCTCGGGCACGATGCGGTCCTTCTACTCAAGCGGCCAGAGCGTCGTCGGGCTCTTNNNNNNNNNNTCTTC
TGCGTACAGCTCGCGCCGCTCTCGGCCTCGGATCTCGGTGCGCCCTCGGGCACGATGCGGTCTTTCTACTCGAGCGCCAGAGCGTCGTCGGGCTCTTCTT
CCTGCTCAGCTTTATCAAGCTGGTGTCGTCCACGACCGCTGCCATGGTGCTTGAGAAGGAACTCAAGATGCGCGAGATGCTCAAGATCACCAACAGTGCG
CTGCTCGCCTCGTGGGTCGCGACGTCCACGATCCTCTCGCTGCCGGTCGTGTTCGTACTCGCGGCGCTCTTGAAATTCGGCAACGTCTTCCCCACGACGC
CGTACGCGACCGTGGTCTTCGTCTTCTGGTCGCTCACGCTCGCGATCGTCGCGTTCGCATACGCACTCACGCCCTTTTTCCACAAGGCGCGCACAGCCGC
GATCGTCTCGGTGCTGCTCTGGCTGCTGCTCTTTTTCCCGTTCTTTGACGTGCAGCCCAAGACCACCGGCGCGAAGTTAGGTGGAGCACTCGCGCCGCCC
ACGGCGTTTGCGCTCGCGATCGATCGCCTGCTGCGCGAGGCCCAGCTCGGCACGGGCTTTGCATATTCTATGACCATGGCCGCGACGACCTCGGCGTTCG
CGGGCGTGCCGTCGGCCGAGGCCATGAGCCTCTTCCTGCTGCTGGATGCGTGTCTGCTGCTGCTGCTCGGGTGGTACTTTGAGCAGGTCGTGCCGCAGCC
CTATGGCGTCCGCAAGCCCTGGTACTTTCCCTTCCAGTTCAACTACTGGCAGCCGCCCCAGGCCAAGTTCAAGCTCACGCTCTCGAGCAGTCCAAACATA
GTGCCGTCACCGAGCTTCTACGCGCTCGGCAGTCCCGACGGCGACTGCAACAACGCCGCCGACTCACCGATCCACCACTTCTCGGGCGGCGCCACGCCCG
GCACGGCGCTGCTGCAGATCCCGATCGCTGAAGAGCGCCGCTCCTCAAGCATCGCGACGCTCGTCGAGCCCGTGAGCGCCGAGCTCGCCGTGCAGGAACA
CACGGGCGCGAGTCTCCAGCTGCGCGCGCTCACCAAGACGTTCAAGTTGGTGGACGGCGAAGAGAAGACGGCCGTGGACGAGCTCTCGCTCACGTTCTAC
TCGGGGCAGATCACGTCGCTGCTGGGCCACAACGGCGCCGGCAAGACCACGACCATCTCGATGCTCACGGGCCTGTACCCGCCGACGTCGGGCGACGCGC
TGCTCTTTGGCCGGTCGCTGCAGACCGAGAGCGACGCGTTCCGCCAGATCATGGGTGTGTGTCCGCAGCACGACGTGCTGTTTCCCGAGCTCTCGGTGGA
CGAGCACCTCGAGTTCTTTGCCGTCATCAAGGGCATCCGCGGCCGCGAGGCCATTGCGCAGTCGGTCGATACGCTGGTCCACGACGTCGGACTCGTGGGC
GCGCGCCGCGTGCTCGCCAAGAACCTCTCGGGCGGTCAGAAGCGCAAGCTCAGCGTTGCGCTCGCGCTCACGGGCGACANNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGTGCTGGGCGATCGCATCGCCATCTTGGCCGACGGCAAACTCAGATGCGTCGGTTCGTCGCTCTTTCTCAAGACGCGGT
TCGGCGCCGGCTACAATCTCACTATCATCAAGCGCAGCAACGGGGACGGCATTCCGTTCGTCGTCGAGAAAGTGCACCGGCTCGTCGAGTCATTTCTCGG
CGATGGTGAGTCGCAGCTCGCGAGCGACTCGGCGTCCGAAGTCGTCTTCACACTGTCGACGCGGTCGTCAAGTCAGTTTCCACGGCTCTTTGACGCACTG
GACCGAGACATGGCGCTGCTGGGCATTTGCAACTACGGCATTTCAGTCACGACGCTTGAAGACGTGTTCCTGAGCATCGCCAACGACCGAGGAGACCATG
ACGACGACGACGTCCCCGCCGCCCCCAAAGCCTCGCCTCAGTCCGTGATGAGGTCACTCACGTCGACGCCGCCGTTCCGAGACCAAGTGCAGACGCAACT
GCTCAAGCGCTGGTGGATCTCCAAGCGCGACAAGAAGAGCCTGCTCAATGCCATGGCCATCCCGCTGCTCTTTCTGCTCGTGCTCGTGCTGCTGCCCGAG
ATCCAAGTCGCGAGCTTCCTGCCCGACTACGCCACGTCCTTTGCCACGCAGGCGCAACAGGACGCGTGTCCACCCGCCCAGATCAAGGAGAATCTGCTCT
CTCGTGCGACCATGGACCGGTGCATGGGCACCGGCTTTGGCTTCTGCTCGCTCGGGCTCATCGACTGCGACGCCGCCGTGTGCTGCGACGCCACGCGCCC
GCAGAGCCCGTTCTACGCGTGCTCGACGTGTCCGATCCCGGCGACAAAGGTCGTGGCGACAGAGCCGTGCTTCTCGTCCAAGTGCATGACGCGCAGCGGT
GCCAAGCTCCAGGTCGCGCTCAACGGCTTCATCGTTGCCATGCTCGTCATGCTCGCGTTTGCCTTTCTCCCAGCGGCCGTCATCGCGTTTGTCGTGAAGG
AAAAAGACCCGACGCAAGACGCCAAGTCGCTCCAGTGGATCTCGGGTATGGCGCTGCCGGCCTACTGGACTGCCAACTTCGTCCACGACATGGTCGTGGT
CTCGTGGACCGTCGTGGCCGCGCTCGTGATAGTTCCGCTCTCGCGGCGCGCGCTGTCGGGACCGCAAGAAGTCGGCGCGCTCGTGCTGCTCGTGGTCGCG
CACGCGCTGGCCATCGTGCCCATGACCTACTTGTACTCGCGCCGCTTCACCAAGCACGCCAACGCGCAGACGTCCATGCTCGTCTTCTCGCTCGCGAGCG
GCGGGCTGCTCAGCATCTTTTCGTTCCTCTGCCGCGTCGTCGACTTCTCCATGACGTCGTCGCTCACGCTGTCGGGGCTGGACCGCGACTACCTGCGCTG
GCTCTTCCTGCTCTTCCCCGGCTACGCGCTGAACAGCGGCATCTACGAGATTGCGACCCGCAAGATCACGCGCGGCTCGCTCTTTGGCGGCCGAAATGCC
GACCCGCGGGCCTCGCTCTTTGGGCTCTTCAAGGGGTTCGGACAGGATCCGCGCTGCGTGGCGTGCTGGAACCGCAACACACCGGGCTGCTGCGTGCGCG
GCACTCTGGCCTTTGACGTGGCACTCGCACCGGCGCTCGTGATGCTGCTCGAGGCAGTCGCGTTCAGCGCGCTCGTGTTTTACCTCGAGAAGCGAGCGAC
GCAGGGACCAGCTAAGAAGACCGAGGAGGATGAGGATGAGGATGAGGACGAGGAGGACCAGGACCCCGGGAAACGAGAGACCATGCTGCAGGTGCTGCCC
GTGACGAGTGACGTGATTGTCGAGCAGGAAGAAGACGAAGCCGAGTACGACGAAGCGAGCGAAGGTGAAGAAGGTGAAGACGACGACGTGGTCGCCGAGC
GGCGCCGCATTGACGCCATGCCGGACGGCGGCACGATCGACGATGCGATCGTGATCCGCCGCCTCCACCACGAGTACGCGGACGGCCGCGTGGCCCTCCA
GAAGCTCAGTCTCGCGATCCCGCGCGGTGAGTGCTTTGGCTACTTGGGTGTGAACGGCGCCGGCAAGTCGACGACCATCAAGGTGCTGACGCGCCAGATC
GTGCCAACGTCGGGCGACGTCCACGTCGCTGGCAAGAACTTTCTCAACCATGGCCGCTCGGACGCAGATGACGAGGACGACGACCATGATGCAGCGGACA
CGGGCCCGTCCGTGATTGGCTACTGTCCACAGTTTGACGCGCTCCATGACCTGCTCACGGTCGAAGAAGAGCTCACGTTGTATGCGCGCATCAAGGGCAT
CTCGCTCGGCCGCGTGCCGCTCGAGGTCGACGACAAGATGCACGCGCTCGGCCTCACCGAGTACCGCCACAAACTCACGCGCGGGCTCAGCGGCGGCAAC
AAGCGCANNNNNNNNNNGGCCATTGCGCTGCTCGGGTCGCCGCCCATCGTGATCCTCGACGAGCCATCCACGGGCATGGACCCGAGCGCGCGCCGCAAGA
TGTGGAACGTCATTGCCTCGAGCTGCGCCGTGCACCGGACGAGCGTCGTGCTCACGACCCACAGCATGGAAGAGTGCGAGGCGCTGTGCTCGCGCGTGGG
CATTCTCGTGCAGGGCCGACTGCAGTGTCTCGGCAGCGTGCAGCACTTGCGCCACAAGTTTGGCCGCGGCTTCACAGTTGACATTAAGCTCGACAGTGAG
CCCACAAAGCTGCAGGTCGCGTCGCTGCGAGGCCGCGCCCACGAAATCTTGGAGGACCATCCAACCGAGATCACTGAGGAGCAGGTCGCGAAGCTGTGCG
AGGCACTGGGCGACGCCTCGCGCATGGAGCGTATCGAGAAGGCGGCGCAGGGCAACGCCGAGTGGTGGAGTCGCGGTGCTGGGGGCGTCCGCACGATGGA
GCTGGACCAGTTTGCCGCGTGGTGGCTCGCACAGGACCGGCACGATGCGCTGGCGTCCTTCTTCCCCCAGCGGTTCCCGGGCACGACGCTCGTGGAGCAG
CACGGCGACCACGTGCGGTTCCACATCCCCAAGCACGCGAGGGAGTCGGCCGTGGGCAGACACGACCGCGCGTCCGAGTTCGAGCTGCGGCCCAAGGCGA
TTTTTCAGGCGCTTGAGATCGGCAAGCAGACGCTGTGGATCCAAGAGTACAGCGTGAGCGACACGTCGCTCGAGCACATTTTCAACCGCATGGCCGACGA
CGGCGTCAACGACGCGGACCGTCTGCGTCCCACGATGGAGGCCGACGGCCAGCGCAGCAGCAGGAGCAGCAGGAACTCCCATCGTGAAGGGAGCTCGTCC
ATGTCTCAGTACGCGCAAGGGGCCACGACGGGCCTGTAG