Transcript Name :
Pytar_ATCC12531maker-par_contig_470-snap-gene-0.7
Orientation:
(+)
Number of Exons:
6
Description :
Phospholipid-transporting ATPase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
156-241
312-844
899-927
985-988
1054-1175
1-132
265-288
865-878
948-961
1012-1030
133-155
242-264
289-311
845-864
879-898
928-947
962-984
989-1011
1031-1053
*** None ***
PositionContextScore
1100ARRRQPR|GK0.646
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4036 bases(100 bases per row)
ATGGTCGACGGCGTCTTTGCCGTGCTCGAAGACCGCAAGCGCCACATCGCCGACGCGCTCGCCAACTCGCGCCCGACAGACGTGCTCGACGCGGCGGCCA
ACGCCTTTGTCTCCAAGCCCTGGGCCGACGTCGTTGTGGGCGACGTCCTTCGCCTACAGAACCGCGATCTCGTGCCGGCCGACATTCTCGTGCTCGCCGT
GAGTGAGCTGCCCGGACAACCGCCGGCGGGGCTTTGCTATGTGGAGACCAAATCGCTGGATGGGGAGACCAACATGAAGGTGCGGTCCGCCATGGAGTGC
ACGATGGCGACCATGGGGACGATCAGTAATCTCTCCAAGATGCGNNNNNNNNNNCTGCTATGTGGAGACCAAGTCGCTGGATGGCGAGACCAACATGAAG
GTGCGGTNNNNNNNNNNCAAAGACACCAAGATCATGATGAGCAACTTGGCGCCGCCCTCCAAGATGAGTACGATGGACCACTCACTGAACCGGTACATTC
TCGTGCTACTCCTCATGCTCGCGACGTTCAGCGGCGCCGGTGCGACAGGCTCCGTACTGTGGAGGCATTCGAGCGGCAAACCCTGGTACCTGNNNNNNNN
NNCCAACAACGCCATCAACAGCTTCCAGGGCGTGCTCGAGTTGGAGACCAGCGACAAGCAGTCGATCCCGTACGAGAGCACCATTCTGCGCGGCTGCATC
ATCCGCAACACGGACTGGGTCCACGGCGTCGTGCTCAACACGGGAAAAGATACCAAGATCATGATGAGCAACTCGGCGCCGCCCTCCAAGATGAGCACGA
TGGAACAGTCACTGAACCGGTACATTCTCGNNNNNNNNNNGCTTCTGATGCTCGCGGCGTTCAGCGGCGCCGGTGCGACCGGCTCCGTGATGTGGAGGCA
TTCGAGTGGCAAGCCCTGGTATCTGCGGCTCGAAGACGTGTCCTCGAACGTCGTCGCGGACTGGATCACGATGCTCTTCTACTACTTGCTCTTGATGTAC
CAGTTTGTGCCCATCTCACTCTCCGTATCCATGAGTATGGTCAAGTATCTGCAGGCGCAGTTCANNNNNNNNNNTCTTCGAACGTCGTCGCCGACTGGAT
CACGATGCTTTTCTACTATTTGCTCTTGATGTACCAGTTTGNNNNNNNNNNGGAGATCTACTATTACGAGACCGACACGCCGACGCTCGTGCGGTCCATG
TCGCTCAATGAAGAGCTGGGCCAGATCTCGTACATTTTNNNNNNNNNNCCCCATCTCGCTCTCTGTATCCATGAGCATGGTGAAGTATCTGCAGGCGCAG
TTCATCCAGTGGGACAAAGAGATCTACTACGAAGAGACCGACACGCCGACTCTCGTGCGGTGCATGTCACTCAATGAAGAGTTGGGCCAGATCTCGTACA
TTTTCTCCGACAAGACGGGCACGCTCACGTGCAACGTCATGGAATTCCGCAAGTGCTCCATCGGCGGCGTGTCGTACGGCCACGGCACGACCGAGATTGG
TCTCGCGGCACTCAAGCGAGAAGGGAAGCCGCTGCCTCCCGCTCCAACCGACTCGTCGGCGCAGAAGGTCCCCTACGTCAACTTTGACGGCCCGGAGCTG
TGGAGAGACATGGACGGCGAGTCGGGAGCCGACCAGAAGCGACGAATCGACGCCTTCTTCACGCACTTGGCGATCTGCCACACGGTGATCCCTGAACGCC
ATGAAGGATCCGACGACGTGATCCTGTCGGCCTCGAGTCCGGACGAACAGGCTTTAGTGGCGGGCGCGTCGTTTCTCGGCTTCCAGTTTCTCAATCGTTC
CCCCGGCTGTGCACATGTGCGCGTGCGCGGCGTCGACCAGAAGTACGACATTCTAGACGTGCTGGAATTCAACAGCACGCGGAAACGCATGAGCGCGATC
GTGCGGCACCCGAACCGACGCATTTTCATCTACTCCAAAGGCGCCGACGTCATTATCTATGGGCGGCTCAACAAGAAACTCGACAGTGCCGGCACCAAGC
TTCTGGACGACACGCGAAACCATATCAATATCTACGCCGAAGAAGGCCTGCGCACGCTCATGATCGCGTACAAGGAGATCGACCCAACCGTGTACGCGGA
GTGGGCGAACCGCTTCCACGCGGCCCAAAATAATCTGGACGAGATCGACAAGCGCAAGAAAGATGCCGCGAACGAGATCGACCGGTGCATGGACGAGATC
GAGTCGGACTTGGAACTGCTTGGCGCGACAGCTATCGAAGACAAGCTCCAGCAGGGCGTGCCCGATGCGATCGCGAATCTAGCCGCAGCNNNNNNNNNNG
GGCGCAACAGCTATCGAAGACAAGCTTCAGCAGGGCGTGCCCAATACGATCGCGAATCTAGCCGCAGCCGGCATCAAGATCTGGGTGCTCACGGGCGACA
AGGAAGAAACGGCCATCAACATTGGCTTTGCGTGCCAGCTCTTGACGACTGAGATGAACATCAGCATTCTCAACGCCAAGCGGTTTCCGACGCCCGAAGC
GATCGAAGACGAGCTCACCCACCAGATCTCGACGCGCACAGCCGNNNNNNNNNNCCATCAGCATTCTTAACGCCAAGCTGTTTCCGACGCCCGAAGCAAT
CGAAGACGAGCTCACCCATCAGATCTCGACGCGCACAGCCGACGTGCAACGGTATTTGGACTCACCACCGCACACTCGCCGTGCGCTCAAGGAGCTCGCG
CTGGTTGTGGACGGTGAGACGCTCATCTTTGCACTCTCGGGCAACTGCCGCTACCTCCTCTCGCAGTTTTCACAGTATTGCAAGGCGGTGATCGCGTGCC
GCGTCTCGCCAGCACAAAAGGCGCAAATGGTCGCGTTGATCAAGGAGTACGTGCCCGGCGTGCGCACGCTCGCGATCGGCGATGNNNNNNNNNNTCCAGG
AGGCCCACGTCGGCGTGGGCATGTCGGGACAGGAAGGCATGCAGGCCGTCAACTCGAGCGACTATGCCATCGCACGCTTTCGGTTCCTCGAGCGGCTCCT
GCTCGTGCACGGGCGGTGGAACTATCGGCGGCTCGCGCAGCTCGTGCTCTACATTTTCTACAAGAACATTTTGTTCACGGCCGCGCAGTTCTGGTACACG
TGCATGTGCGGCTTTTCGGGGCAGAAGTTCTTCCTCGAGACGGGTGTGCAGCTCTATAATCTCTCGCTCACGTCTCTGCCCATTGTCGCGCTGTCCATCA
TGGACCGCGATGTGTGCGATCGCATGGCCATGAAGTTTCCCAAGCTCTACGCGAGTGGCCCGCGCGACGAAGACCTCAACCCGAGGATTTTTTCGACTTG
GGTGCTAGGCGCCATCTACGAGTCGGTCGTGATCACACTGGTGGCCATCCACAGCCTGCACAACGCGTCGTTCCACGCCGCGAGCAGCTCCATGTGGCTG
CAGGGCAACGTCATTTTCACGCTCGTTGTGCTCATTGCCAACGTCAAGCTCATGCTCTTTCAAAACAGCTTTGTGTGGCTCAACCACTTCTTGTACTGGG
GGTCCATCGCCTTTTGGCTCTTGGTCGCAGCCGTCGCCGGTAATATGGACGCGCTCTCGGATCTCGCGTGGGAGCACATGCTTGAGCAGACATTCCAGAC
GATCGGCTTCTGGCTATTGCTGCTGTTCTTACCCGTGGCGTGTCTCTGGGCAGTGTACTTGCTGAACGGCTGCAAGATCGCGTTGTACCCAGAGTACTGG
CATCTCGTCAAGGAAGTGACCAAGTTTAAACTGGATGAGACCAAGCTCCAGTGGGAAGATCTAAGCAGTTCCTCGGTACCCGTGCCAGCGAGAAGAAGAC
AACCGAGAGGCAAGAAGCCAAGTCGCCCCGGACTCGTGATCCCGATCAACGATGCCCACCGTCGACCGAGCACCAGCGCGACCCAAAAGCTGTCGCCGAG
ACCGCACCACGGGTTTGCCTTCTCAACGGATCCACACGCTGGCGCTGCTGAAGCGAATCTCATGCTCAAGCCCAGCACGCTAGAGATGACGGATGCAGTC
CTGGACGACGCGGATCCGGTTCGAATAATTAATTAA