Transcript Name :
Pytar_ATCC12531fgenesh_masked-par_contig_285-abinit-gene-0.33
Orientation:
(+)
Number of Exons:
1
Description :
Tetratricopeptide repeat protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat11.033PS50005
Tetratricopeptide repeat-containing domain26.07PS50293
Tetratricopeptide repeat8.467PS50005
Tetratricopeptide repeat8.349PS50005
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat0.0083SM00028
Tetratricopeptide repeat34SM00028
Tetratricopeptide repeat0.11SM00028
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1024
*** None ***
PositionContextScore
686RFARAKR|SL0.82
819LRHKHKR|SV0.78
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3075 bases(100 bases per row)
ATGGACGACGAGGACGACTTCTTTGCCGAGCTGTGCGGCGTCTCGGTCTCGGACATGGGCACCGCGGCCGAGGACGAGCGCGTCGTGCTGCAGGACGCGT
GCCTCGCCATTGAACGCGCCGTGATCGAGTCGCGTGCTGCGCCAATCGACGCGTCGCTCGCACACGTGGCGGCCATTCCTGGGGAGACGCAGCGCCTCCA
AGCCGCGCTCGCGCTGGGGAAGCTTATCTGCGAAGGTAGCTATGCCGAGATCGTGCGCGGCGAGATCGGACAGCGCGTCGTGCAACAGGCGCTGCTGGCG
GTTCAACCCAACGAAGACAAGAACCAGCACTTTGCGACGCGGATCGCCAAGCGACTCGAAGCCTTTGTCGCCCATGGCAGCAACAACGATCACGAATTCG
ACCAGTGGGCGGCGAGCTACGAGGTCTTGTTTGTCGCGATTGCATTCTTCAACCTGTTTGTCCAGGCCAATTACACGGGGCCCGCTATTGATCCCGACCA
GGTCAAGGATCTCACAGCGATTGCAGCGCAGGCGCTAGGTCTCGCTGCTGATGACGATGCTGGGAAGGCTCACCGCGAGGCTGTGCTGGTGCTTCAAGTG
GACGGAGAGAGCCCCTTCACGATTTGCGAGTTTCCGTACTTTCTAGCTCTTGGCCGTGCGATGCTGAGTTTTGCTGGCAACGCACGATTTTCCAATTGGT
CGGTCGCCGTCCAGCAAGTCAGTTCTGGTGATGACGATGACGATGAGGATGTCGCAGCGTCTCCTATTGTCTCATTGGAGCTGCTGGCCGTGCTCGACCA
GCTACAGACGGCGTGCTGGTGGAACGCTCGTGCTGCTGTCGCCCACGAGCGGTTGCTGATCGCCAAGGAACCGTCCACGACGCTGTGGTTTGAAGCGCGC
CGCGGCTTTGCCACGACGCTTCGAAACCACACGACGCTGTTTGCCGACACGTCCGAGCCTCAGCACGGCGTCTACTTGCACACGCGTGCGCTGATCGAGT
GGGGGCTCGCGCAAAACTACTTTGACAAGAACAAGCAAGGCAAGCGCACGTTCCAAAAGGCCCATGAGGTCAGTGGGCTCACGGTCGAGCTCTCGGGGTC
CATGGGCAAGCGCACAAAGTTCCAGCAGAAAAGCGTCGCGCAAATGGTGCTGCTCGCAGCATCCAAGTATCCGCCAGTAGACAAGGACGCTCCGGCGTCG
GTCTACGCCAACGCCATGGCCGATGCGACCCACGCCGACTTTGGCGGCCGCAATGTGGAGCAGCCTTCGTCCACGGGGCCCGATAGCGAGCTCACGGAAG
AAGAGCTACGTATCCAGCAGCTCGTGCAGGACGGTGAGGCTTCGTACCGAGACATTCAGCTCGACCAAGTGGACCCGGACAATATCTTGCTCGAGCAGAT
CCACTTTGAAGACGGCTCGCTGCTGTCGGCGCAGGGCAATTTGCAGCCCATGGACCAGGTCGTGCTGCTCTCGCTGTGTCTCGACGTCAAGAACAGCAAT
GCCGGCGACGGACTCACGCGGGAAGAGATGATCCCGTACGTGACGCGCGTGCTCGAGAACCCGAACAACTGGATGATCTACTCCACGGGGCTGCTCGAGC
GTGCATGGATAGAGTGCGAGTCGGACAAGCGCCGCGAACGCGCCGTGCTGCAAATGCAGGCGCTCGTGGACCAGCATACGACGCGGCTCACGGTGCTCCA
GAACTCGCTCCAGGCCATCGAGGACGCTGCGCCCGTGAGCGAGCGCATGGCGTTTGTCTATGCGCTGGCGTTCCCACCGCGGTACGCACTCAAGCGCGAC
CTCGCCGAGCGGTACTCCAAGCTCGGCGTCATGCGCAGCGCGCTTGAGATTTTCCTCGAGTTGGAAATGTGGGACGACGTCGTGCTCTGCTACCAAGTGC
TCGACCAACCCACGAAAGCCGAGCAAGTTGTGCGTGCGCGTCTCGCGGTCGCCCCGACGCCGTACATGTGGACGTGTCTCGGCGACCTCACGCAGGACAT
TTCGCACTACGAAACGGCGTGGGAGCTGTCGGGCCACCGCTTTGCGCGTGCCAAGCGATCGCTCGGGCGGCACTACTTTGAAAAGGGCGAGTATGACACG
GCGATCCAGCACTACTTGGCCAGTGTCGAAGTGAGTCCGATGCACAACCCGGCGTGGTTTGTGCTGGGCACCATGTCGATGCGCACGCAGAACTGGGCGC
TCGGGCTGCGCGCGCTCACGCGCGTCGTGCAGCTCGAGCCGGACAATGGCGAGGCCTGGGGCAACATTGGCTCGATCCATCTGACCAACGGCCGGTACGC
CGAGGCGTTCAGCGTCCTGAGCGAGGCACTCAAGCAGAAGCGCGAGATGTGGCAAATGTGGGAGAACTATGCGTTCTGCGCTATCCAGATTGAGCGGTAC
GGCGAGGCCATGTACGCGCTCCACCAGTGGCTCGATCTGCGACACAAGCACAAGCGCAGCGTCGACCATGAGCTGCTTGCGTGGCTCGTTGAGGCCATTG
TGTACCCAGGGGAGCTGAAGAAGGCCGATGCGGTCAAGGAAGAAAAGGAAGACGTGGGCAGCGTCATGGAGGCGGCCATGGATCTCGCCCAGCAGCTCAG
CAAAGAGGACGACGACGAAGAGGAAGAAGACTTGGCAGCTCTCGATGAAGCGGCGCTCGCGACGGATGCGACGCCACCGCAGTCGCATGCCAACTACAAG
AAGCAGCTCGCCCTGTTGTTCGGCCGAATCACGACCATCTCGACGAGCAACCCGAAGATCTGGCAGGTGTACGCGCACTTTAACGACGGCGTTGGCCGCA
AAGAAAAGGCGCTCGACTGTCGGCTCAAGCAATGCCGCGCGCTGCAGATCGCTGGCTGGGAAACCGAGCAGACGAGCGTCGACGAGCTTTGCCGCGCGGC
CGTGCGGCTCGCGCAAGACTACATTGCGGACGGCTCAAAAAAGGCGCTGTACGCGTGTCGACTCTACATTCGCGGCGTGCTGAAGAAGGCGCAAGTCGAC
TTTGGTGAGCTAGAGGCTGTGCAGCAGCTCGCGAAGACGCTCGAGCAGGTCGAGACGCTTGAGAAGCAATTGTAA