Transcript Name :
Pytar_ATCC12531maker-par_contig_192-snap-gene-0.9
Orientation:
(+)
Number of Exons:
4
Description :
Proton-dependent Oligopeptide Transporter (POT) Family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
134-139
205-215
317-425
481-498
556-579
1-111
163-181
239-296
444-457
522-535
112-133
140-162
182-204
216-238
297-316
426-443
458-480
499-521
536-555
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1815 bases(100 bases per row)
ATGGCCAAGTCGCACACTGCCTCGCCGTCGCCCGTGCGCACGCCGCTCGCGCTCACGCCCGGAGTAACCAACTACAGCACCAAGCTCTGGGACGAACGCC
CGACGTTCATCAAGCAAAATGTCGTGCGCAACGTCTGCCTGCTGCTCTTCGTCGCCACAGCGCTCGAAGAAACCGCAAGCTTTTCCATGAGCCAGTCGCT
CAAGAACTTTTTCCAAAAGCTCGGCTGGTCCAACAAAGGCTCCAACACCATGCGGCTCATGTATGACTCAGTGGCGCAGTTTGCCTGCATCTCGCGGGCT
ACGTCGCGGACGAACGCATTGGCAAGTTCAATACGCTGTTCCGCGGCGCGTCGCTCGACACGATCGGCTTCTCCCTGCTCGTGATCGCATCGCTGCCCGC
CGTGCTCGCGTCCAAGACCGTGGCCAAGGTGCTCTTCTCTGCGGGTCTCTACCTGGGTGTCGCGCTCACGCAAGTCACGCTGCGGTCCATGATGCTGTCG
TTTGGCGGCGACCAGTTCTCTCCCGATCTACCGCCCGACAAGAAGGGCTTCTTCTTCAGCTTCCATTATGCCGTCGCCAACATTGGCGCCACGCTCGGAT
ACGCCGTGTTCCCAAGCATCTGTCTCCACGGCATTGGCTCCATCCCGGCCGAGTACGGGTACACGGCCAACTACGGCATTGGACTGCTCTGCCTCGTGGG
CTTTCTCGTCATCTTCTGGACCACGCGCAAGCGGTACGTTAACGTACCTCCGTCCACGCGATCGATCGGAGAAGTGCTGCGCATCCTCGTGCACCAAGCC
AGGTCCAACTGGCGTGCACGCTTCATCGTGGCCGGTGGTGTGCTTTTTCTCGCGGCACTCGTTATGAACGTCGTCGGGCCTTTCTCGCCGACCACGGCTC
CACGGGCAAGAACATCTCCAAGGCCAGCGGCGCCTTCATCGTCGCGGCCTGTGTGTTGTGGGTCGCCTTTGGCCGCGACTCGAGCTTCATGGACGCCGCT
AAGCAGCGCCTGGGCGGCCACTTTGACGAAGAGATTGTCGACGGCGTCAAGCAGGTCATCCGCATTCTGCCGTTCAACGCCTTCAACGTGGTCTGGTGGG
TCTGCCAGAACCAGCGCGCCAACAACCAGACCATCGTGCAGCAGACCGACATGCGACTGGGCAGCGGGCCCTTCGCGCGCCAGATCCCGGGCCCAACCAT
GCAAATGTTTAATCCCGTCAGCGTGCTCTTTCTCGTGCCGCTCTTTGACCGCGTCGTGTACCCGCTATACGAACGCGTGGCCGGCAAGCCGGCGTCGCGG
TACGGCAAGATACTCACGGGCTACTGGCTCGCCGTGCTCGCCATGGTCTGGACCGGGTGCTTTGATTTTCTACGCAAGAGCCGCCCCGTGCTCACGTACG
NNNNNNNNNNAACATCCTCAACAACGACGGTCACCAGGTCATGAACGCCATCGCGTGGTACGCCGCGATCCCGCAGTACTTTCTCGTCGCGCTGGCGAGT
ATCCTCATTGTGATTCCGAGTTACGACATTGGGTACTCGGAGGTGCCGCAGAGCATGCGCAGCACGACCGTGGCGCTGGGCTTTTTCGTCAACTCGATGG
GCTCGACGCTCCAGTCCGTGGTTGTGCTCTTGCTGGGCAAGTTCATTCCGGCCAATCTGAACAAGGGCCACATGGAATATCTCCACTTCACGCTCGCGGG
CATCATGCTCGTCAACATCTTCTTCTTCTGGATCGTCATGCGCCAGATGCAGCTCGGCATGGTGCCCAAACTCGCAAAGGCGGCCAGGACCAAGCAGATT
GAGATCGCAGTCTGA