Transcript Name :
Pytar_ATCC12531maker-par_contig_19-fgenesh-gene-0.8
Orientation:
(-)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phox homologous domain11.09PS50195
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-608
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1827 bases(100 bases per row)
ATGTTCATCCTCACGTGCGGCCGCAGCAGCTTGGGTCCCGATGAAGTCGAACGTAACGAGGGCCAGGACAGCGAACGCTCTCGACAAGCGGCGGCTGCAG
TCGTGACCCCGTTCGACTCAAGGCGTGGTAGTGGCTTCAGCGGCGGCGATTCCTGGGCAAGCTCTCGAAGCGACCGCGTGGATGAAGGGGAGTCCCCCGC
ACCACCTCGGCGGGTGGATCCATCGCTTAGCCGTTACGACAGCATGGCCACGCGTCTCAAGACCGCGAGCCGCTCCGATTTTCCGTCACTCTGGGCGTCC
GTCGGGCGAGAGAGCACGACAACCAAGCGGAAAGATACGCTCACAACAACTAGCGTCGACGGTGAAGAGATCCCAATGCCCGATCTCCATGTCGGCCAAT
ATCAGTTCTTTTGTGACCCGCAGACGTGGTCGCCCATGTTCGCGTCTCCTGGGGACTTCACCGTGCGAGCGGAGGCTGCGTGTGATCAAAGTGGCGGCAG
CACCGCGCTGCGCCTCGCGGTCGTGTGCTGCTCCATTCGACCACTGAAAGACGCCCCCACGACAGAGACTACAAAGCGAAAATCCTTCGTCAAGATTATC
GAGCGGAGCGAAAGCGAGTTGGTCAAGTTTTCCGAGACCATGGCACTCAAGTACCTCGGCCACCGGCTCATGGACAGATTGCCGAAGCTCACGCTGTCGG
TGCTCTCGTCATCGCAGCCACAGATCGAGGAGTACGCCGAGGCCGTCACCGCGTTTCTAAGCTATGTGCTCAGCATCACCGAGATCGGGTACAATCGTCT
CTTGGTGTTAACCGAACCCGTCGCGGAAAATCTCATTGTGCGCGAGTTTTTCGATCTCTCACTGGGGTTCGGAGACCCTGGCATGGTGTCCACAAGTTCC
TGTGGCGCACGACTCGAGCACCGAGCCGCTAGCGATCGGACATTACTCCCAAGCGCCTGGTTTGACGCCATGGACCGAGCTGGTACGCACTCCAAGTCGT
TCTCCCTTACAGGTCGTGACGACTCGTCATCGCGTCGTATGAAATTGATGCAGTCGATATCGAGTCGTCGCCTCAGTGATAGCGGCTTCGACTTTCGGGC
ATCGGGGTTCCGTTCGCCACACCATCATCAGTCACCCAATACGCCTCATGAAGACAACCGGTCTGATGGTAAGTGTATCCGCTTCATCAAGCCAGGTCGT
TGGAACCAAGAACGCTCCGCGCCAGGTGCCTTCACAGTCGAAATCACGAGCGTGACGATCTCCGACGCGCGAGCCAAGTATACGATTTGCGTGATCTTCG
AATTGAGTGGTCGACGAGAAATTACTACCGTGGACCGTCGATTTTCCGAGTTTGATTCTCTGGTGAATCGCATCGAAGCGAAGTTACGCATGCTCTCGTT
GCGGAACCATTTCCCCACCAAGACGCTCTTTCGGTATCTCTCGATTGGATACCTTGAACGCCGCGCTGCACACCTGCAACGCTTCCTCGAGAAACTGCTG
CAGATGCGGTTCTTTGGTGTGCTCGACGAAGAGGTCACCATGGTGGCCGAGCCGAACGTCCGCAAGTTCCTAAACCTTCCCAGTGTCCAGTGGAGCATCA
CGCCGTGGCGCGTGCCGCGGGGCCCGCGTGCGAACAACCGACCGACAGCTCACATCAATGGAGGCACCGACTACACTGAATCCTCCACGTCGAGAGCATA
CCCGCCACCAAGCTACACCTCGTCTCCCAGCTCAAATGCCAGCAACGAATCCGGAGCGTACGAGTTCGAAGATGTATCGTCCCCTCGATTCACCAACTTT
AGCCAAGCGCGAAGTGGCTCGATGTGA