Transcript Name :
Pytar_ATCC12531maker-par_contig_1-snap-gene-1.7
Orientation:
(-)
Number of Exons:
1
Description :
Alpha mannosyltransferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-770
NN-scoreoddsWeighted Score
0.6782.5080.005
*** None ***
TypeScore
mitochondrial391
GO
*** None ***
*** None ***
*** None ***
Sequence
        2313 bases(100 bases per row)
ATGCTGCCTCCGACTTCTGCGCCTCCTTCCGTCCATCCCATCTCGACCATCCAGAAGACCTCCACGCCACTAAGCAAGACTGAACCACCGCCTCTGCCCG
ATGTATTCTTGGTCATTGGCGTCAAGACGCGCGTGCTGCGCGGTCTGGAAGCGCGACGCGCCATCCGCGAAACATGGGCGGCGCCGGCGACCACCGCGGC
GCTCGGCGTGCGCGTAGTGTTTCTCGGCTGCGAGCCCGACCTCTCCATGCTCACGAAGACGGACAAGGTAGCAGCGCAGCAAGCGATCGCAGCGGAGAGG
GCAGCGCATCGAGATCTCTGGACCCATGAACTGCAGTGTCAAGATTCGTTCTTTACGCTCGTGGACAAGGTCGTGGCGTTCTTTGACGTAGCACATAGGA
CATTCCCAGCGCTGGCGTACGCGATGGTCGTGGACGATGATGTGTACGTGCGGCTGGACCGTCTCGTTGCGCTGCTTCGATCAGACCGGATCCCGAATGA
GCGGTTCTATGGTGGAAACGTGGCCGAGAAGAAGCAGCTCAAACCCACGCAGCCCATCCGCAACCCAGAGAGCCGCTACTATCTGCCCATGGACACGTAC
CCCATCGCCGAGCTGCCCTCATTTGTTGCCGGTGCCCACTTTGTGCTGTCCAGGGATGTTGTGGAGTTCATTGCTCGGAATCGACGCGACCTGCGTGGGC
TCAAGGGCCTCGACGACGCCACCATCGCGTTGTGGATGCTCGCGCTGCAGATCCGCCCCGTGATTCTGCTTGAATTCCAGATCGTGCGCTCATGCAACTG
CACGGAAGAGCTGGTGTCGTACGCTGACTTGGGCCCGCACGCGATCCGCACGGCGCATTGGAATCTCGTCGCCAACGACGCCTTCTGCACTGGATTCAAT
TACACGCAGTGGTTCAAACAGTACGACACGATCGACTTCAGCGACGACGACGACGCGGACGACAATGGACGGGACAACGATGGACGGGACGGCGATGTGG
AGTTCAGTTGGGATCTGGAAATCGACCCAATGTCTCCGCGACTACACATTCTCACGACCATCACTGTCGCGAACCAAAGCGTTGAGCTGCGGTACGCACC
GGCCTCAGGGACCTACTCGAGTGCGTTCTGCAACCATATCCTCCCGCTGCTCGAGGCCAAGCTGTCGATTCTCGTGGGCACAAACTTCTGTCGCTCCCAC
CGCAAGTTTCTGCTGCGGTTTCTCAAGACCCACGACACGACCATGCCGTCGGTGCGGCCGCTGCTCACACTGGCAAGGCACAATCTAGAACGCGATGCCG
TCGACGACGAGGCCAACAGCACCAAGAGCATTCTACAGGTTCGCGTAGTGGCGCCGAAAGAGAGCGTCTCGCTTTACGCGCTTGTCGAATGTGTTTTGGT
TGCCGTATTCCCCGAAAAGCACATTGTCGTGGTACGCGACCGCGACGAACGTCACGGCGCGCAGCGTCCAGACATCGTGGTCGTCGTTGGCTCCGCTGAA
ACCATCGACGCCGACCGATCCGCTCGTCGATCTAATGACCCAAACGCAACGATGATCATGATATCAGCCGATGGCCGACGCATCCCAACGCCCAAGAGCG
ACCCGCGCACTGTGGTGATCGACTCTTCTGATCCGTCAACCACACGTGCCACCCGTCATCTGTACCTGCCGGCGGTGTCGGTGGCTCTCGCTGGCACTCT
CCGCTACAGTCCCACGGTGCTGCTTCATCCAGTCGTCGCCGATGAGGATCTACCACAGTCACGAGCGTTCTGCGTCGTCGGCACTGCGCACCAGAACGTG
ATGCCGAATCAGCCGCGCGATGCTAATGACCAAGTCGATGCGATCGGCGTGTGTGCAGCCCATACGCTGGTCCCGACGTCCCAGACACCGACGGACGATG
CGATCGATTTGTACAGGCGCTACAAGTTTACCATCACTTTTGAAGACGACGACGTAGCCAATACCCCAGGGTTTGTCAGCGAGGGAATTGCGTTGGCTTT
TCTCGCGCGGAGTATCCCTGTGTACTACGGTCACTCCGCGACCGTGACTCAGCTCTTCAACCCGAAGGCGTTCATTGATTGCCGCAGCTTCATGTCTCTC
CAAGAATGTGGAGACTATATGCGGGAGGTGCATCATTCGACGTCGCTCTACGAAGGCATACGACGCGAGCCACCCATCACGAACACCACGGCGTTTCTGG
AGTTGTTTTCATGGCACCCGCAGGTCGCCGAGATGGCGATACAAGATGGGAAAGAGGCCTTGCTTGTCGGGCATCGCCTTAGACAGCTGCTGCGCGGCCC
CTTGTCAATGTAA