Transcript Name :
Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-0.8
Orientation:
(+)
Number of Exons:
4
Description :
Beta-1,3-galactosyltransferase 1
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Glucose/ribitol dehydrogenase7PS51257
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.710.82927
InsideOutsideTMhelix
1-4
27-475
5-26
NN-scoreoddsWeighted Score
0.763.320.007
*** None ***
TypeScore
extracellular, including cell wall333
GO
*** None ***
KO ID
K07819
*** None ***
Sequence
        1833 bases(100 bases per row)
ATGGCGAAGCGCTGGGTGCGATGGGCGATCGTCGCGGTTGCGCTCCTCGCCTGTATCATCCTTCGCGCCACGACTGCAGACAGTGATTCGCTCGGTGCAT
CTCTTCCAACGGGGACCGTCGAATTGAACGTCGCGCAGGACGCCGCGGACATCGCACACGAAAAACCTCACGTCAGCAATCCCACCGAGCACCATGACGA
GAATCTGCTTACCTGGTTGAGTCGCCGCGACCACATAGAGCCAGCAAACAAGACCAATGGCACAAGCATGCACTTGTCCAATGCGTTCCTACTTGTCGGT
GCCAAGACTAGTGTCGTCCACGGATTTGCGCGCCGCCAAGCGATTCGCCAGACGTGGGCGAGTGCAGCGTTCGTACCAAGCGGCGTCAAGGTCGTATTTC
TCGGCTGTGAGTCGGATCTCTCCATGCATCCTCCGACCAAGCAGCAGCAACTGTTGGACGCGATCGAACTGGAGAAGCGTGTCTTTGGTGATCTTCTCAC
GAGTGAGCTGGTGGGCTGTCTCGACTCGTTCGCCGGGCTCCCCGACAAAGTCAAGGCGTTCATGCACTGGGCCGCGGCCACCCAACCTTTGCTCGCGTTC
GTAATGGTCATCGATGATGATATCTATTTGAGATTGGACCGCGTGATGGAGCTTTTGCATCGTCCTTCAACCCCAAGCTCTCGCTTTTTTGCCGGCAACT
CTGCGACCAGTGAGTACCGTGGCCTCGCCGCGCCCATGCGGGATCCACGCCATAAGTACTACATCTCCGCTGACGTCTACCCGATGGCAACGCTCCCGCC
ATTTCTCACGGGGGCCCATTTCATCTTGTCGAGCGATCTGGTCCGTTTCATCTCCAAGAACTTTGTCGATCTTCGCGGACTCGGCGGTATTGATGATGCG
ACGATCGGCCTCTGGCTGTTTGGAATGCTGCAGATCAAGCAAAGGTACTTTGACGAGTTTCACGTACTGCGAAAGACCAAGTCGTGCTCTGACGACGTCA
TCTCGCTGGCCGATCTCACAGTATCAGCGACACGATTTATCCATGAGAATGTCGCTCAGGGCCGGCGGGTCTGTGAGAACTTCGAGCGTGCGCAGAGACT
CAAGACAGTTAGGACTGTGGTGGCGCCTCCAATCACAACAGGAGCGAAGTCCGACGCAGCGGCGATCAAGGAGGGCGACGACCCGTGCTTTCTTCACTGG
GATTTTCAGCATGACGCGGTATCCAATCGCCTTCAGATTGCGATACAACTGACGGTCGGGGCGGTCGCTGTGGGGTTTATCTATGTACCGTCGGCGAAAC
CAGCCGAAGACGGGTTTTGTGGCCAAGCGGTATTGATTCTTCACGAGAAACTCTACCTCACAGTCGGCCGTGAGTTGTGTGCGCACCACTCGCACTTGCT
CCTCTCAGCGTTAGATCGAGATGTGCAAGCAAAACCTTCCTTCGGGCCAATGCTCGCGATTGCGCGGCATAACTTACGGCGATTGCAGCTATGTGAAGAG
GCTGACAACGTGGTATTCGCGGCCACTAACGAGACTCGTACAACGTACACACCAGTCGAGAGGNNNNNNNNNNTTATGTGAGGAGGCTGACAACGTGGCA
TTCGCGGCCGCTAACGAGACGCGTACAACGTACACGCCAGTCGAGAGGCCGTACCTCACGGCCGTCCTGTCGGCCAATGCCCATTCGTTTCGCGTCATTG
TCGAGTGTCTGCTTGTGGAGCTCAACCCACACCAGCAAGTGCTCGTGCTGACGCACGATGAAGCCTCACGAGTGCCGACGCGTGCGGATCTGTACGTTGT
GTCAACTTTCGGTGGGTCTGAAGCTGCGACTGA