/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_3066012786e6facc6e314a2dcc55f4c9 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1223556 -w 120 -web -o /tmp/images/bd_log_output_file_3066012786e6facc6e314a2dcc55f4c9
Transcript Name :
Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-0.17
Orientation:
(-)
Number of Exons:
1
Description :
LMBR1-like conserved region family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
23-28
111-130
186-382
452-521
1-4
52-87
154-162
406-428
545-647
5-22
29-51
88-110
131-153
163-185
383-405
429-451
522-544
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1944 bases(100 bases per row)
ATGGCCGTGCTTTCGCTGCTACTCGAGGCCTGTGGGCTCCTGGGGTTCACGTGGTGGCTGCTGACGAGATATCGCGACGCGCATGTGTCGAGTCTCGGTC
TTGCAGTCGTGTTCCTTAGCTGGACGCTGGGCTTTGTGGGGTTGCTGCTCCTGCCCATCGACATTGCTCGCCACGGTAAATGGCTCACGGGTCGTAATAG
TGAGAACGAAGGGGATGCTGCCGCCGACGACCAAGCGAATGCCACCGATCTATCGACTTTCCTGGCCGTTTGGCTCGCGCTCTACTGGCTAACGTTCGCG
CTCAGTTGGCTAGTGCTGCCACTGCTCGTCGAGTTTTCGCAGCATGGCGAGTTCCGCTTGCAGCGTCGACTCGTAGGTTCGCTACAGCGGCTCGTACTCC
ACTGGACAATTGTCGTTGCGGTCATCGCAGCCGCTGTCGTCTACTTGCTGTTCTTCGGCCTCTTCACACTTGAAGGTCTCATCGGGCTCGCCATGGCCAC
TGCCAACACGTACGGTCTCGTCTGGCTTATCGTGCTGCTGGGCTATGGGCTCGCCGATATCCCACGCTCGCTCTGGACGCTGCGGAACCCGGAGCGTCGT
CTGCGCGAGCTGAATTTCCGTGCGACGCAGGTCCACCACGAGCGCATGGAGGCCATCTTCCTCTATCAGGATGTGCTGAGGGATGTACGCGTGGCCTACG
AAAGGATGCTCCAGGCTGAAGGCGCGTCCATCATCCTCACGAGCGACATGCAAGACGTCAAAGCCGGATTGCTCACGGTGCTGGCGTTGGTCGATGAAGA
CGAACGGGAGACGCAGCCGTCTTCCCCGAAAAAGGCGACGGCCACCAAGCTGAAGACGACCTCGATGTCGAGTCCGATGCTCTCGACTTCGACAATGCAC
TTGGTATCACCACCCCCGTCGTATAGTGACGTCGTGGAGCTTCACCGCCGCGTGAAAGCTGCGCAAGCCGACCTGCGCGGCACGGAACAGGCGTGGCTTG
AGCTCTGTGAACGTGCGGACGCGCGCCACAAGCAGGTCGCTTCGCGGAGCCACACGGCGCTGCCGCCCGTGGGACTTTACTCCACGACCAACCTCCTGGC
ACAGCTGCTCTCGCTCACGATGACTGCCGTAACTGAGCTCCAGCGTTTGCTGCTGCCGCTACTATGGGCGCTCGCTGCACTGGTCACAGCTTGCGGCTCG
CTCTGTGTGTTGTGGGGTGAACTCACAATGGGCTGGGGGATCCAGTCGCTGTCGCTTTCCCATTTGCTATCGCTGGCGGGACCTAGTGGACTGGAGATGG
CCGTGTTTGTGCTGCTGCTGTACATGGTGTTATGCGCATACTCGTCGCTGTTCAAGCTGCGGTCCTTTGGGCGGTTTGCGCTGCGTGGTCACTGCAACTC
GAGCGAGCTCGCGCTGCTCAAGACGGCGATCCACCAGTGCCGCCTGCAGTTTTCACTGAGCTACAACTTTGTGCTGCTGGTGGATGCGCCGACGCTGACT
GACGCTACGGCGTTCCACCAGCTCTGGAGGCGCATGCAGGTCGTGCGCGTGCTGGGACGGGACTTTACAGTGTACATCCCCATTCTCATGGTCGTGCTGG
TCGCCTGCACGCTGACCAATGTCTACGCCCGCGTCATGAAGTCGGTCGTGGGCATGGAGCAGTACGAGCAGCTGCTGCCCGGCGACGCCGATCACGAGAA
GCAGGTCGCCAAGGGCGACCAACTCTTACGTAAGGCGCGCGACAAGCTACGGCGTCGCAGTGAGCAGCAGCAACGAAATGCTGCGGCCTGTGGCGTGGCG
CTCAACAGCGACGGCACCAGTGGTGGCACCGACCGCGTGCAGTGGCGTGGTCGAGGCATGCAGGCGCCGCAGGAGATGGCGGCGTCGCTGTTGGCGCAAG
AAGAAGAAGACGATGACGACGATGACGAGGACAGTGTCGCATGA