Transcript Name :
Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-0.0
Orientation:
(+)
Number of Exons:
1
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-19
84-87
38-60
20-37
61-83
NN-scoreoddsWeighted Score
0.8233.820.008
*** None ***
TypeScore
nuclear261
GO
*** None ***
*** None ***
*** None ***
Sequence
        264 bases(100 bases per row)
CACAAGTACAAGACCCGTGGCTGCTTCTCCAAGAAGAAGTACACGCGCAGCTGGGAAGGCAGCGCCTGCGTCTTCATCTCTGGTCTCGTGTTCCCGGCGC
TGCAGTACGCCGACTTTGACAACTTCACGCAGGTGCTGCTGTCGATGCTCATCCTCGCGCCGACCATGGCGTACGCCGAGGCCACGGCGCCGCACACCAT
GGACACGCCCGTGCTCATGATCGGCTGCGGCACCATCCTCTACGTCATCACCAACGTCGTCTAA