Transcript Name :
Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-0.19
Orientation:
(-)
Number of Exons:
3
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-633
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2061 bases(100 bases per row)
ATGACCGAGCGCGTGCTGCAGCTGCTCGCGCGGCCGTGCGTGCTGGACGCGCTGCAGCGAGACGACGCGCTCGAGACGCTCAACGACATCTCGCCGCTCT
CGGACCACTACATCCCGACGCTGCAGTACCTCGTGCGGCCCGACAACCGTTCGTATTGCACCCTCAGTTCATTGCTTATTCGTGGCTCATATCCTTCTTC
TGTGGTTGGCAGTCATCGCGCTCGTATTCAGCATGCTTGAGGAGCCCCCTCCCCAGGTGAACGAACCGCGACGCCACCGATTTGAGATCTCTGAGCCGTC
ATACGACGAGTACGCGATCGTGTTTCGCGCCCACTGGGTGCTGTGCTCGTCCAGCTTTTCGTCGCAACTCGTCTCGGCGATCGTCGGGCTTCGGCCGCTC
GAAGGATCCACCAATGCTCCGTACCACTCACTCTGCGAACGCCTCGCGACGTATTATTCACGCGACGCCATGAACCTGGAAGCGCTCTCGCGGTTCCTAA
ACTTGTTCATGGATCAGTACTCACCAGAAGCCCTCATCGGGTTCCTGGGACCCATTTACGAGGTACGTTTCGTGCGGTCGCTGCTCGTGCTGATCCACTA
CGAGCCGATCCGCGATGTGCTCTTGCGGCTCTGCAATGAAATGGCCAACACGTGCGCTCCAATGCGTGCCATCACGACCCAGTTACTATGTCAACTCGCG
CCCGAGCGAGTGGTCAAAGAGTCCGTAGACGATGACGAGGTCCTCTCGCACATCCAACACGACCCGCCTCACGTCCAGTTCTCGCGCATGATCTTCACGT
GCGATTTGCTCACGGATCTGATCCACGAAAAGCGACACGGGACGTTGGGCCACCACGTGATCCACGAACTGCACTCGAGCGAGAACCACATTGCACACTT
GCTGGACGCGACCGTGCGCGATCTCGCGACGCTGCCCACGCAGCTCGCCAATGAATCGTACGTCATCAAGGTGCTAAACTCACTACTTCAACAAGCGCAG
TGCGGCTGCGTCTCCAAGATTGCCTTCTCGGCGGTGTTTGCACGCCACGCGGAGGCCACCAATGGTGGTGCGTCGGTCGACGACGCACTGCTGAGTCCAC
ACGTAGATCTCCCACTTATCTGGAAGCGCTTCATAGAACGTCTTCCTGACCTGCTGCGGTTCCTCGCGATTGCTCCAGCCCACCGATATCGCAGTGCCCA
CGTGCAGATGATCTACCTGATGCTGCCCATCTTGAACGTGTCGTGTTCCGCCGTGGACCGCCATCTCATCGCCCACAAGACCATGGAGGCGCTGCTGGAT
TTACTCATTCGGTTCCCGCAGGCCAACATCTTGCACTGCGCCATCTCGCGGCTCTTCATCGTGGCGCTCGAGGACTCGCCGTTCATGTTTGGCAAAGAAC
TGCCGGCCTTTCGTGCGGCCAACGATCCCCTGCGGCTCCACATGCTGCTGAACGGCTGCTTTGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAGTGGCGGACGGACGCCGAGTGCCGTCGCCGCCGCCCGCGTTTGTGGACATTGCCATCTCGTTTGATCAGGCGGTCACCAACGCCCACGCGCACT
CACCGCAGCTCTTCGAACGCTCGACCATGGAGCGTTGGCACGCGTTCCGCTCGCAAGTCTTACTCCCAACGCAGGCCCAGTGGGAGGAGCAGCAAGGACA
GGTGATCGCCGCGGCAAGCCCCTCCAAAGTCCAGGCTTTTGTGGACGGCGTCAACGAGCTCTTTGATCCGAGCGAAGGGATCATGGTCATGCCAGTGCCC
GAGTCGCTGCTGCCGGCCATCGAGCCAACCGCTAGCGTTACTACTAAATCCGTTGACGATGTGTCGGCACCGGAACTACCAGGAGCGATCACTCCACTGA
ATGGAGGAGACGAGTTGTTCTCGACGCCGCTGTCGGCGCTGTACAATGACGAGGAAAAGCACATCATGCTTCGCGTCGCCAGCGATAAACCCGTGACCGC
GTCCAGGACTGCGTCCTTTGTGGCGAAACAACCCTTTGGCGGTGGATTTGTCGTAGACTAA