Transcript Name :
Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-1.2
Orientation:
(-)
Number of Exons:
6
Description :
Si:ch211-193c2.2
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Pleckstrin homology domain9.692PS50003
HmmSmart predictionP-Valprediction_id
Pleckstrin homology domain3.5SM00233
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pleckstrin homology domainIPR001849
*** None ***
InsideOutsideTMhelix
1-1464
*** None ***
PositionContextScore
691LNERTKR|GY0.53
TypeScore
nuclear739
GO
*** None ***
*** None ***
*** None ***
Sequence
        4928 bases(100 bases per row)
ATGGAGGTGGACGCCGTGGGCGGCAGCGTGGAGGAGCCGCGGGCGCGGCGCGTGGCGTTTGCTGGCGCCGAGTACATTGAGTACGATCTGGACGCCGCGC
CCGTCGTGCGGCGCTGCGGCGTCAGCGGCCAGCGAGAGCTCGTCGCTCGCTCCGACGAGGACATCGCACTAGAGTGGCGCGCGCGGCTGCTGCAGCGACA
GGTCGACCGTGTCATTCGCACGGGCTCGCACCTCGTGGGCGACGGCGACGACGGCGCGAGCGACAGCGACGACGACTATGCGATGGACGGCTGGGGCCAA
AAGAAAAAGCCCGAGCCGGACGCACAGGGCATGCGCGTGCGACTGGAGAAAGAGTACGAAAAGGAGATGCGCACGACGATTGAAGACCGCGGGTTCCCGT
GTCTCGACGTCGCGCTCGTGCCGCTGCGCGTGCAGTTCCAGGCGTCCGAGCTGTTGGTCGCGTGGTCCGTGGTCGCTCCCCACGCCGTGGACGACTCGGC
GGACGTCGGCTCGCTGGACGCGGCGGTGTCGCTCGACACGCAGCGCAAGCACTTGGAGCTGTGCCGCAAGCAGGTCTTTGGTCCCGTCGTGGACGGCTAC
GCGTTTGGCCGGCGGTTCTTTTCGATCGACTCGTTCTTGTCACTGCTCGAGCTCGAAGAGCTCGTGGCGTTGGCCGAGGCCCACGGGCTCGACGTGCCAG
CACTGCCGACCGAAGTGCTGGCCAAGATCAAGGTCGCGGACCGCGAACTCATCTCGACGTACTCGCCCACGGGGCTCGGCAAGCCCCTCAAGATGCTCAC
GTTCCGAGAGCTCGTGGAGGAGGCGTACGCGCGCGGTATCCTCATGGAGGAAGAGAGAGACGCCAAGAACAAAAAGTCCAAGCGCGCGTGGGTCGACGCA
TTGCGGGTGAGACAGAGAGCTCCCTATTGAGTGCCAAGGGTTCAGATACTAATGTGGGGTGCTTGCTGCGATACAGCCGGCGCTTCAGGCCGAGATGCGC
GCATTCAAGATCCGCGAAGCCCATGCTGATTTGATCCACACGTTTCTCGCGACCAGCCTGGACGCCAAGATGCAGTCAACCCGCATGGAGACAATCGTCG
AGCTCATTCACAACTACCTGCGGACCCACCCCGAGGCCAGTAATAGCGACAGTCCAGATAACGAGATGGCGGCCGTTCATCGATACTTTCGCGCCTTGCT
CGACTGGCACGCGAGCCAACGGACGGAGGATACCACCGGGAACTCGGACGCAGCTGCGCCTTCCACACCTCCCTCCACATCGCCCCCGTCGCAGCCGCCT
CGCGTTCTCGAGCCCATGTCTCCTATCGTGTAAGTAGTTTGAATATAATTTGGCCGGTTTGCTCATCACATCTGTCTCCCCTAGTATCGCACATGCATGA
GTCCAGCGGCGCCGGTTGTGGATCGTGGGACGGATCAGAGAGGGAGAGAGAAGTTTCGCACCAAAGATGGATGGCGTCAGGTACTCGCTATTGTTAGGCG
CGCGTGACCAAGACTGCGGAATGGGAACGGTGCTTGCTCCTCCCATGGGACGTCCCAAATTGAGCTGCCGGACCGGATTGCCTCCGTATGGGCGAGTCGA
GACGCCCATGACGTCGACCCGGTCCGTGGCCAAGAGCAGCAGCATGTTCAGTCTGTCTCGACGGCCGTCGCTTTCGGTCGCCGCGTCGCCGCCGATCTCT
CCTATTGCGACACCGCCGAGCCAGATGACGGCGAGCCCCACGACGCTGGCGACCGCCCCTCCGTCGTCGGCCAATGCGTCGCCCGTGCGCGAGGATCTCG
GCGATGGCTCGGCGAGCGGGACGCGTCGGAAGAGTAACAACGACAAGCTCCATCGACTCGGTAGCAGCTCCTCGATCACCGGCTCACCCAGCGCGCTGTC
GCCACAGGCTCAGTCCCAACAGCGCAAGCTCATGCGGTCCCCTACGGCCGACACTTTCCACCAGCACCAACACCAGCAGCAACAGCAGCAGCGACAGAAG
AGCCGCGACTTTGCGCTCGCCGTGTCGCCGATGGCGTCGCCGATCCCGCACGAAAACTGCTCATCCCTTCGCGACCAGTTTCTCAAGATCAAAGAGAGAT
TCTCGGCACCGAGCCCAGTCAGCGGAGGAGCAGGAGGAGGAGGGGCAACGTCTCCGGCCTCACCGTGTGGCAATGCTGTTCGTGCCGCTTCGCCAACAAC
CACCTCGCCACCTCCACCAAGCTCTGCTGTATGCGGAGACACAGTAGTGCCAGGCGATGAGAGAGCAACAACAGGGCGAGCCGACCGACGCGCGTCCGCT
TCGTCGCCGGGGCTAACGATGCCTGTATCTGTCCCCACCGAGCGGCTGCTCGTGGAGCTAAACGAGCGCACGAAACGCGGCTATGCCGGTGATTTGCTGT
GGCCCAACCACGCGCACGTCGAGCGCTGGTACGTCGAGGACAATTACTTCAAGGGATCCATGACCTGCGGGTCGATGGAGAAAGGTGCCGAAGTTATCGC
CCGCATTGCGCGTGTCATTTCCAGTCGCATGTCCCCACCACCTCCGGTCGCAGATCCACAACCAGCAGCAACAGGGACCCCGATGAACGCGACTCCGACC
AACTGTACGAGTCGCTTCAACCCGGACGTGTCGCTCCAGTGGATTGGCCGCCAGCTTTGGGCGGTCACGGTCTCACTTCCTCTGACGCGGGCCGGGGAGC
TCACGGGCGAGCACGCGAGCGTCGCGCAGGCAATCGACGATGCGATCGCGGAAGAAGTTGAAAAGGCGCCACAGGAATGCGGCCCACGTGCGACCGCGGT
GGAGACGTCAGCATCAGTATCCAAGGACTCCCCTTCCAGCGGAGTCCGACTGAATCCGTTGTTAGATCGGTTGGAGGAAGAGTATGCAGCACATGAAGAA
GAGCCGTCGCAGCAGTCGGCGACGCTGCCGCTCGTCATCACGACAGCATTGGCAGACGAAATCGCAGCGACCCACGCCAGCATCGAAGAGCATGCAGTGC
ACTGTGACGAGCAGGTCGCGACGCCCGAGGATGCAGTGAATGAGCAGGACCCACAGATTCTGGAGGCCGATCGACGCGCCGTCGCGAGCGATAGTTCGAG
CACCGTGCTTGCCGACGAGGACCATCAGCACCAGCCTCAACACCACGCAGACGACGACGAGCACGCATCGTCACGGTCGTACCACACGACTCAAGAGGAC
GGCGATACGCTGTCAGCCCTACCGCTATCTCTGTCCATGCTGTCGTTCACGTCGCTCCAGTCGCTCTCGAGTACTGGAGGCGATCCACAGCACGGGGTAC
CCAGTACGAGTGGCGGTAGCAGCAGCGACCCCCTGCAGCTCCACAACGGCTGCGGCCGCGACGACGACCCGTTGCACCGCGTGCCTCCGGACAAGACTGG
CTGGCTCAAGAAGAAGAACGGTCTCAACGCGTGGCAGCCGCGGTACTTTGAGCTCAAGGGCAATCGGCTGTTTTACTTTGCGTCCGAGAGCGAGGGCATC
CCGCGCGGCGCGATCGTGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGACCACGCCCACGTGCTGCGCGGCAAGGGCGACCAGAGCATG
ACGTTCACGATCTGCGCGTCCAGTGGCACGCAGAGCCTGCAGCTCATCAAGTTTTCCAGCCGCATGACGAGCCAAGTGCACCCGTACGAACAGTAGCTCT
TGATCTCTTTCTCTGCAACGTTTCGTCTCACTTACGGATGCTTTTCTGCAGGCGCAAGTCCTGTGTGCTGCGGGTCGTCCAAGAATCGGAGGACGCCATC
GCAGCGTGGGTCACGGCGATCAACCGCGCGTCGTTCTACTGCCACCTCAGCGCCAACTCGTCGGCCTCGGGTTCGTCCTGCTCGGTCCCGCAATCATCCT
CTTCCACGACGTTAACGTCGTCGCCGACGCGTAAGAAAAAGACGTCGTTCTTCCGGTTACGCTCGGGGTCGTCGTCGGGCTCGTCGGCCGATGACGACGG
CACGCGCTCGTCCACGGCGACCTCGGTTTCGTCGTCCTTGTCGTGCGCTGCGCCTATCGACAGCGTGTCCTACCACCACTACGGCAGCGTCAAGTACCTA
CAAGACACGGACCCGCTGCTGTGGGAAATCCACCCACACGACCAGCAAAAGATCCGCAAGAAGGCATCGCTCGCGCGTACACGGTCCGACTACCTCTCAA
TTCTCTCCAAGTACACGGCGACGTTCCGCCAGATCTTTCTGCCGCGCCCGCGCCCCATCACGATCGAGCAAACGCTGCGTGACATATTGCCCGAGCTCTT
TCTCATCAACAACGTGCTCTACGGTGGTGGTGACGAGAACAACGGACTGGAGAACATCTTCGAAGTGCTCGACGCGCTCATCAAGAAGTTCGCTGGCGCC
GCGCAGGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTGCAGGCGTGCGCGCGCACCATCAGCGGCGGCGACTCGTACTTTGTTGTGC
ACTCGCTGCTGGGCAATCCGTTCATGATAATTCGACCGGCCGAGGCGCGCGGCCACCCGATCGAGATCGACGTGTCGGCTACGCATCCGAGCCAGTTCTG
CATCACTGTGTTCAGCGCGTTCTCGTTCCACCACATTGAGGATGTCGAGAGCTTTGGCGACCACAGCGACGGCAGCGCCATGCCCGAGCCGCTGCTGCGC
GTGCAAACTTACCATGTACAGGAGTTTGACTTTGCCAGCGGCAAGTCGACGCGGTGGCTGCGGATACGCACGGACGGGATGAAGGACGACCATGACGCGG
GAGGAGGGACAACGGGGGCGGGAGGACGGCTGGGCAGTACCACGGGTGCTGGAGGTGGAGGAGGGTGGATGTCCAAGAGGTCGCCATCGGACACGGGGTT
TGGCGCACTGCTGGACGCGCTGTCCTGA