Transcript Name :
Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-1.4
Orientation:
(-)
Number of Exons:
2
Description :
Protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain32.103PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain1.5SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-436
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        1390 bases(100 bases per row)
ATGGGCAACGCTGTCGTGCGCGTGAACGGCCACGAGTATGACCATGACGGCGTGCTCGCCGAGGGCGGCTTTGCGAGCGTGATCCGCGTGAGACGGGGTG
GTGCGCCATACGCGCTCAAGTGGACGCGCGGCATCGGTGACGACGCGCAGCTGCAGCGCGTGCTGCTGGAGATCCAAGTGCAGCGCAAGCTGCAGCACCC
CAACACCATGCGGCTCGTCGAGGCTGAGGTGCGCGTGACCGGCGCCAGCCGAGGAGGCGGCGGAGGGGCGTCCCCCGCCAAGAACAGGAACCACGCGCCG
CGAAAGGAAGTACTCATGGTCTTCCCACTATATCCACGCGGGACGCTTCAGCAGCACCTCGAGATCGCCGCCCAGCAACGTACGATTGAGCTGAGAGCTG
AGCGCGCGATGGTTTTGGATTGTAGAGACTGATGATTCTCTGTTGTCAATCTCTATAGGCATTACGGCGTTCTCCGAGGCCGAGTGTCTTCGCCTGTTCA
CGCCGCTCGTCGAAGCCGTGCTGGAGCTCCACGCCAGGGGGTTCGCCCACCGCGACCTCAAGCCGCACAATATACTGCTCACCTCCAGCGAACCGATGGA
GCCCGTGCTGACCGACTTCGGCTCTCTCGCGCCTGTCAAGACGCAGATCGTGAGTGCCCACGATGCGCTCGAGCTGTTTGAAGACGCGGCGCAGTTTTGC
AGCGCCCCGTACCGTGCCCCGGAACTCTGGGAGTCCCACTCGTCCACGGGCTTGAGAGGCGAAGTCAACAATGGCAAATGCGACGTCTGGTCGCTTGGCT
GTGTGCTGTATGCCATGGCGTTTGGGCCGTACTCGCCCTTTGAGAGCGGAACGGAGGGCGTGCTGCGGCTCGCCATCTTTAGCGGAAACGTGCGGTTCCC
ACCCGACAAGTCGCAGTTTGGCACGACATTTTCGCGGGCGTTTGTAGATTTCATTCTCTGGATGCTCACAGTCGCGCCCGACGAGAGACCGACGATCTAT
CAAGTGCTGGACCGAGTGGACGATCTTCGGGCGGGCCGTGCTGTGGGCGCGCGTGGCGGCAGCAGGCGGAGCCTCAGTCTGCGCCGATCACTCTCCAAGA
AAGTCATCTCCCAAAAGTCGGGGCTTGACGACTGGGCCGATTTCAGTGCCTTCAACGACCTCGTCAACGACCTGAATGATCAGGAGACCAAGAGCTCCGC
GTCGGCGCACTCCTCAACCGTGTCTCGATCGTCCTGGCAAGTCGTGTCGGGCAGACCCTCGCTGGCCGATAGCTTGGCGTCGCCGCAATCCATCGCGCGC
GTGTCCAGCCTCCGCGGTCACGACATGGACCAGAGACGCACGCTGTCGCTCCGCGGCAGACAGTTGCTCGCGTCGGCACTAACGTCCTAG