Transcript Name :
Pytar_ATCC12531fgenesh_masked-par_contig_1-abinit-gene-0.98
Orientation:
(-)
Number of Exons:
3
Description :
Carbohydrate-binding protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Chitinase II2.1SM00636
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5940.77617
InsideOutsideTMhelix
1-4
23-342
5-22
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
chitinase activityGO:0004568IEA
chitin catabolic processGO:0006032IEA
*** None ***
*** None ***
Sequence
        1174 bases(100 bases per row)
ATGTCCATTACAGTGCTGTTCCTCGTGGGCGTCGTGGTGGCGGTCGCGGTGCTGATCAACTCGGCGAAAAAGCCCAAGACTGCCAGCGGATCCGACGCCA
CCAAAACCGCCAAGAGCGACAACGCCACCAACAAACCCAGCGATACCAGCGCCGCCAACGAGGTCGTGTCCGTCTGCGTGGCGCGGCGGCCGGGGCCCCA
CACGCGTACGGTCGCATTTTGGCAGAGCGAGGTCGCCGGCTGTGAGAAAGTACGTGCCACGCACAAGTGGCGCGAAGGTCGCTGGAGGGCTGATGTCGTG
CGAATGTGGTTGTTGCTGTTGCTCCTGCAGATCCCAGCAGGCGTGACCCACGTCGTGTTTGGCTTCGCGCTCGTGGATGCCGCCACTGGACGCATCGTGC
CGACGTTCCAAAACACGGACGCCGAGATCCAGAGCTGCGTCAAGACGCTGCGCGCGTAGGTCGCCGTTTGGGATGGACTCTCCATGTGGAACGGTTTCTG
ACGTTTGCTCTTCTTGCAGCAACTGTATCGCGTCCCTCGGCAGCATCGGCGGCGCGACCAACAACAAAGCGATGGCCAACATCACGGACCCCAGCGCGTT
CGCAAAGTCGGCAGTCGAGTTGGTCACCAAGTTTGGCTTTGATGGCGTTGATATCGACGACGAGACCGCTGGTCCAGCCTTTAACGCCACTCGCGCCGTC
GCAGTCGTCGAGGCCACCCGCGCGGCGCTGACCGCCAAGGACAAGTCGCTGCTGCTCACGTACGACGCGTACTTTTACGAAGGCGACCAATCGTGGTGCG
CCGACCCCGTCCACAAGGATTACGCCCGGTGCTTCCCAACCGCTCTCCTGCCGTCACTCGACTGGATTAACATTATGGCGTACAACGTCGCGGAAGTCAA
CGCCACGGCCGTCCCCATCTACGAAAAGGCACTCAACACGACGTTTGCTGCGTGGAAACTGGTGCTGAACGGCGACTTTACAAAGGCCACGATCGGCATC
TGCGTCGACGGCTCGTGCGACTTCGGCCCCGGTCCCAGCACAGCAGTGATCGCGCGGTGGAATGCCTTTGCCCGCGTAGTCGGCACCGGCGGAGGCATGA
TGGTGTACGCAGCGTCCAGCGAAATCGCGAACGATTTTTCTGTCACTCGAAGTGTGCTTCCTCGCACGTCGTAG