Transcript Name :
Pytar_ATCC12531maker-par_contig_1-snap-gene-0.36
Orientation:
(-)
Number of Exons:
8
Description :
Regulator of chromosome condensation (RCC1)
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Regulator of chromosome condensation, RCC13.7PR00633
Regulator of chromosome condensation, RCC13.7PR00633
Regulator of chromosome condensation, RCC13.7PR00633
Regulator of chromosome condensation, RCC13.7PR00633
Regulator of chromosome condensation, RCC13.7PR00633
Profile scan predictionP-Valprediction_id
Regulator of chromosome condensation, RCC19.117PS50012
Regulator of chromosome condensation, RCC116.052PS50012
Regulator of chromosome condensation, RCC112.373PS50012
Regulator of chromosome condensation, RCC113.64PS50012
Regulator of chromosome condensation, RCC114.022PS50012
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Regulator of chromosome condensation, RCC1IPR000408
*** None ***
InsideOutsideTMhelix
1-1257
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4455 bases(100 bases per row)
ATGGACCAAGAGGGTACGCGGCGACGCTTCGCCTCCTCGACGCTGATGAAGGGATCGCCGGCCATGGGCCAGCGCGAGAGCACCACCCCGCACGCGCGCC
GCGTGGACCCGCGCTGGGCGCGTCTTGCACTGGAGCAGCTGCGCGACGACGAGTTCCTGGCCAAGCAGCTGCGGCGCCAGGAGACGCTGGCCGGCGCGCG
GCAGGCGGCGAGCAGATCCAGTGCGCGGCGACAACGACCGCGAGCGGGTCTCTTTGTGGACAGCGGCCGAAGCGTAAGCGGTGGTAGTGCCCTCTGGACG
CAATTGCTCAAGCGCCGAGCGTCGGACGACCCAGCGAATCCAGCAGCAGGCGATGAGGGAGACGAAGACGATGGGGATCCGCATGGGAGACGGAGTACGC
AAGAACAGCGCCTACAGACCGAGCATACGCGGGACGACGAGCTTCTCCACGCGCTCGTGCTGCTGGGCAACCTCTCGCAGCCGGCGCGCGCCGCGTATTT
GCTGAGCCATGTCCAAGACCAGCTCACGCGTCTGTGTCACGTGGCCGATCCGGTGGCCGACGTGGTCGCGCTGCGGCGTGGGATCTTGTGCGACGTGTAC
GACGCCGTGGCCCTGCAGCACCAGCACGCTCTCGGTGCGGTTGCAGCGCTCCAGTCGGCCGCCAACGTGATCCAGCGCGCGGCGAGTGACAACAACGACA
CACGCCAGCCCGTCAGTGCGATCGCGGCGACTCGGCCATTGGGGTCCACCCCGTCGGATCCGTTGGCTGCCGAACCAGTCCTAGCGACGGACATAGCCGT
CGAACTGCTCGACGGGTTGCTGGAGACGGCGATGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGCGCCGAGGGTGGAGAGCTGCTGCCGA
CGCGCGACGTGTTTGATGAGGTCGTGAGTGTGGTGGAGCTGTTCGCGCCCTTGTCGCTCCTGCAGAAACCATCGCCTGCCAAGCTCTCCTGTGATAAGAC
GCACGTGGGCCGGCTCGTGCGGAAAGTGCAGCAGTTCCTGCTGACAATTGCGACGGGGAAACTGGGTGAGTTGACTGACGTGGCCGACCGCACGCGTGCC
GTCAATGCGCTCGTTCGGCTCGCCGCGGCCAGTGGATCTGTCCGTGATTTTCTGGCGATCGTAAGCGTTCTACTGGGCATTGGCGACGGTTCTGTCACCG
CATGCGACGCGCCCACGATGAGCCTCGTTGACTCTGCCATCCCCCAACAGGCCTCGTCGCCGCGAGCGCTGTGGCTGCTACATGCGAATGCGTCAGCGTC
GACGTCGCCGACCTCGAGTCCGCCTAAAATTGCACTGCGAGAGCCCAGTATCCCCATGCGAGAATACGACGCTNNNNNNNNNNTGCTACATGCGCATGCG
TCAGCGTCGACGTCACCGACCTCGAGTCCGCCTAAAAGTGCACTGCGAGAGCCCAGTATTCCCATGCGAGAATACGACGCTGGCGACCAGGTCGTCGCTG
ACGACGAGCGCGGCGATGTGACCGATGAGCTGGCCAACTTCGCGGTGGAGCAGCGGCTCAAGCAAGTCCACAAGCAGCGCGGTGACCACGGCGCGAAAGA
ACTGGACGTGCAGACGACCGCGGTGGACCAACTGCTCTCGGTGCACTCAAAGCGCAAGGCCGGTGGCCCAAAAAATCNNNNNNNNNNGGACCAACTGCTC
TCGGTGCACGCAAAGCGCAAGGCCGGTGGTCCAAAACATTTGGTGGTCGTCCACACGAAAGCTGCCGTCTCCAGCGTCACCATCGCGGGGGCTGCTGGGT
CGTCCTCCATCATTGCTCATCGCTCCTCAATTCTACATCCGCTGANNNNNNNNNNCACCATCGCGGGGGCGGCTGGGTCGTCCTCCGTGATTGCTTATCG
CTCCTCAATACCGCATCCACTGGCGCTCGCAGGCAAATCCCACCCGAGGGCGACGGCGAAGGACGAGCTCAACAACCTCTCGCTCGAAGCTGATCTCACA
TACTCACTGGACGTGAGTACGTCGTCGCGGTCAGACACGTTCGTGTCACCAGTGTCGCCTCGACACGTACCGGTAATCCCGTTTCCGATCACCGTGTGCC
CCACATTCAATCCGCTCCGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCGTGGTGGCCGCCACCCAACTGCCATCCGCCCTTCACC
CCACCACGATCCTCACGGCTGGGACGACGACCACGAAGTGTGGAGCTGTGGGCAGAACTCGTACGGCGAGCTAGGCCACGGCGACGCGGTGACGCGCAAG
AGCTTCGACCGCGTCGAGGCGTTGCAGCAAAAAGACATTGTCTACGTGAGTGCCGGCAACGAGCATACTGTCGCACTGAGTGCGGACGGCTCGGTGTGGA
CGTGTGGATACAACGACAATGGCCAGTGCGGCCACGGTGTGACGACGCGAATCCCACATCTCACGCAAGTGCCGAAACTCGGGCTGAACGATACTACGAA
CGACGGCACATCCCGCGTCACGCAAGTGCACGCGTACAATGGCTGCGAGCACACGATTCTCGTGACCCACGACGGCAGGGCGGCATCGTGCGGATACAAC
TACCGCGGGCAGCTCGGTCACGGCACCACGCAGAGCGAGAGCGTACCAAAGCTCTTGCGTAGTCTGGACGGCAAGATAGTGCGCCTANNNNNNNNNNGAT
ACAACTACCGCGGGCAGCTTGGTCACGGCACCACCCAGAGCGAGAGCGTACCCAAGCTCTTGCGTAGCCTGGACGGCAAGAAAGTGCGCCTGGTGTCTTG
TAGTTACTACCACACGGCGCTGACGTGCGACGGTGGTGGGCCCGCGGGCCACAGTCGCGTGTATACTTTTGGACGGAACGACTTTGGGCAACTCGGTCAT
GGAGATACCATCGATCGAAAGGTGCCACAATGCGTTGAGGCAATCGGGCTCCCTGGTGACCTGCACGTTGTGTCGATCGCGTGCGGCCAGTACCACACTA
TGGCCGTGACCTCAACGGGAAAGCTGCTGGCGTTTGGGAAGAACGACTATGGCCAGCTCGGCGTCGAGACGGTCGAAAACCAGTTGACGCCAACCCACGT
TAAGTACGGTCTCGAGCGGCAGACGTGTCTCGACGTACGGTGCGGCTACTATCATTCGATCGTGCTGTGTGGGGGTCCCCACGTGTTTGGCTTTGGACGC
AACGACTACGGGCAGCTCGGGATTGGCAAGGCCAGCAACGCGGCGTCGACTAACCTCCAGCTCCAGCAACAACGATTTGCAAGACCTCAACTGCTGGATG
ATCTTGAAGGCAAAGAGATTGTCCGTGTCGCATGCGGTTGCTACCACACGATCACGGTCTCGGACAATGGCGTGCTGTACGTGTTTGGTCGGAACAACCA
TGGGCAGCTGGGCACCGGCGATATGAACGAGCGATTGTATCCGTATCCAATCGACTCATTCGTGGGCAAGCGTGTCGCGCTTGTGGCTGCCGGATTTTAC
CACACGCTCGTCCTCACGGGCGGCAAGGATGATGAAGAAGCTGCCGGCGGGGAGCAACAGGACGCTAGCCACACTACCGATGCGGACGCCGCAGATCGGA
TNNNNNNNNNNCCGGCGGGGAGCAACAGGACGCCAACCACACTACGGATGCGGACGCCACGGATCGGACAGATGGAATGGCCATGTCATGCTCCACGATT
CTCGCTAGTCCGTTTGTCCAAGAGCTCTACAATGCCAAGGGGGATTGTAAATCTGCTGATGTGCCCAAGGCCACCTCCAGTTCAACGACCAATCATCCGG
AACGGCAGGATCAAAGCAGTGACATGGATGCGGACGATGGACGCACAGAAGATCGATCTGGGATCTCTCCGGCCGATGTGTCGGTCATCAAGGCCGTTGA
TTACCTCGTGAGATCTGCTCAATTAGTTGTACGATACGACGAGGAGGGGTATGGTGCGGGTCATCCAGCACCGCCAAGCAGTACGACTTCCATCGGAAAC
TCTCTCGATGTGGTCGTGGTCATCCTTGCGCAGCTGGATCGACTATGTTCGTCCTTTTCGGCCAAGAAAGGAACTTCATTCCCTATCGCCCAGCTATTGC
CAACAAGTGCAAGCGATCATATGGTGAGGAAAAGGGATCCGAGCGCCGATCTCTGCGACTTCGTCGATGGCAGCTTCGAGAGGTTTGCGATCGAGGTTCA
CGGCGCGACGTTCACCTCACTGGGCTGCCTCATTGCCCAGCTCAGTAGCCGACGCTTTGACTCACTGAACTCAACAGGTATATCCTCTGCTTGCTCTCGT
GGATCCAACGGATCGGGAAAACTCCAGGCGTATCTGCTCGATGTCTGCTTTCGACTGCTCCAAGCCAACCTCGCCCAGGTGCTCCATTCTGGTCTCGGTA
GTCTGCTGATCGCTCTGCAGCAAACCGAACCCACACTGTGTCCCCCACGAGATGA