Transcript Name :
Pytar_ATCC12531snap-par_contig_1-abinit-gene-0.134
Orientation:
(+)
Number of Exons:
2
Description :
Protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain39.368PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain4SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
107-478
1-83
84-106
*** None ***
*** None ***
TypeScore
nuclear348
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein phosphorylationGO:0006468IEA
KO ID
K04422
*** None ***
Sequence
        1519 bases(100 bases per row)
ATGGGCGGCGTCGTCTGGGCCGAGGACGCGCAGAACCCGAGCGTGCCGGACCCGGTCATCCGCGTCCACCAGCGCAAGGGCAACGGCACGGCCATGAACC
TGTACGCGATCCACTTGAGCGACGCCGTGTTCTCGGGCACCGAGTCGTGCCGCATGCGCGGCGACTTCATCGTGCCGTGCCGCGACAAGCTCGACTCGGA
CATCGACCTGTGCGCCGCCAACTTCGGCTCGACGGTCGACGCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCGGCT
CGTGGCGCAGCCGCAGCAAAAGGTGTTTTCGCTCACGGCCATCATCTGCGTCGGCATCATGGCCGGCGTGCTGCTCGGGCTCTTTGGGCTCGTCTTCTAC
ATGCACAAGAACCGCCAGAACTTCAAGACGTCGTACGAGTCGCACGCGGCGACCACGAACCTCATCTCGCTCGGCGGCAAGCACCAGAGCAGCGCGGGCG
GCGCGGCGGCGCTCAACTCGATGGACATTTTCGAGGCCCACGCGCGCGCCGAGGGCGGCGGCGGCGATGACGACACGCTCTCGAACGACGCGCTGTGCCA
CCGCTCGGGCGTGCTCAAGCGGTTCGTCTCGGACCCCACCATCATCACCAAGCGCCTCGCCTTCTCGCAGCTCAACTTTCTGCGCGTCCTGTCCAAGGGC
GCGAACGGCGAGGTCTGGCTCGGCCAGTTCGAGTCGCGGTACGTGGCCATCAAGTGCCTGCTGCCCACGAAGCGCCGCGAAGTGCGTGCGCTCGAGCAGT
TTTCCGAGGAGATCCGGCTGGCGTCCATGCTCGAGCACCCGCGGATCGTGGCCTTCTGTGGCATCGCGTGGCACTCGCTCGTGAACCTCTCGATCGTGAC
CGAGTACATGGAGAAGGGCGACCTCGAGAGCGTGCTGTCGCAGCCCATGGCCGAGTCGCTCACGTGGCAAAAGGAGAAGCTCACGCTCGCCAAGGACATT
GCCGACGCGCTCGTGTACTTGCACTCGCTCATGCCCGTGGTCATCCACCGCGACCTCAAGTCCAAGAACGTGCTGATGGACAACCAGCTCCGCGCCAAGC
TGTCCGACTTTGGGCTCAGCCGCGAGACGTCGACGGAGGAGACCATGACGAACGGCGTCGGCACCATCCTCTGGAGCGCGCCCGAGGTGCTCGAAGGCAA
GCGCTACGACGAGAAGGCCGACATCTTTTCCTACGGCATTGTGCTCTCGGAGATCGACACGTGCGCGCTGCCGTACGGCTTCAACAAGGACAAGACCCGC
AATAAGATGAAGAGCATGCAGATTGTGCACCTCGTGGCCGAAGGCAAGCTGCTGCCGACGTTCCGCGACGACTGCCCCGAGGAGCTCGTGGAACTGGCGC
GCTCGTGTCTCGACCTGGACCCGAGCAAGCGACCGAGCGCCATGCAAGTCGTCTTTACGCTGCGGTCCAAGCTGTATCCGCTCATGAACAAGGCGGTCTC
GAGTGTTGAGTCGTCCTGA