Transcript Name :
Pytar_ATCC12531fgenesh_masked-par_contig_1-abinit-gene-1.21
Orientation:
(+)
Number of Exons:
7
Description :
Isoform 2 of Uncharacterized protein CXorf57 homolog
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-769
*** None ***
PositionContextScore
234AWNRRRR|YC0.715
265HVNRKKR|LA0.758
434HRHRPHR|DG0.511
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2903 bases(100 bases per row)
ATGACGGAAGCGGCCTTCATGACGCCGCCTGCGCGACGCGCGCGCCAGCAGCGCACGAGTCTGGGCAGCGTCGCCAGCAGCGGCAACAGGAGCAGCAGAC
GCGGAAGCAGCTTGCTGGGCAGCGGCACCGAGAGCGAGCTCACGCCCAGTGGCACGCAGATCCTTCATGCCGGACTCAAGCGCACAGGCCGCCCGCTCAC
GCTGCAGGTGCTCGGCGTCTACCGCTGTACGTATCTCTGAGCAGATCTCCGCCACGCGCATGTGGTCATATGCAGGGCACTGAATCCGTGCACTGTATTA
GATGTCGCTGATCCCGTGCTGAGAGGCGTACTCCCGCCGGAAGCCGCGGAGGCACTCGAGTGGGACGTGTTTGATTTGGTCGTGAGCGACGGACAGATGA
AGATGAAGGCGATACTATCGCCGGCACTCAACGACCTCGTCTGGCGCGGCCTCGTGGGTGAATTGGATATTGTAGAGATTGATGATTACGAGCTTCTCAC
CATCCACGACGACGAGGACGACGACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAGCCACGCAGCGTCTGCATTATC
AACGAGCTAACGCCACGAGTGCCACTGCTCACCGCCTCCCAAGCAGACGATGACGCGTCCGAGAATGCGCCAGCCTCCCAATCGACGATCCCAGCGCCAC
GTGCCAAGATTGTGTACTCTGTGGGCAGTGCGCTGCTGCCGTCACCGCTCGTGCACGGCAGTGCCTCGGGCGTACCTGACCTGCAATTCATCTCAGAGGC
CCACATTCGCGACCACGGTGCACTGCCGCTCGCGGGCAAGCGGCTCTACTACCTCTCACTGCTCTCGGACGACTACCCCGCCGACTGGGAACCCGTGCAG
TGCGAGCCGCTCACGCCCGTCTCCCGTGCGACGCCGTGGGCCGCGTGGAATCGTCGGCGACGGTACTGCACCGACATTTTCACGTCGCAGGACCGCAAGG
TCCACACCATCCGCGAAGTGAATGTGATGACCAGCCACGTCAACCGCAAGAAGCGACTGGCCAGCGAGTTGGACGAGGACAGCGAAGCCCAGCCATCGAC
CATGACGCCGCCACCGATGATCGGCATCGTGCAATTCAAATCTGCGCTCGTCCACACGGGCGCGCCGAACGTCGTGAACGAATTTCCGTTCATGTTCCAC
ATTGTGCTCGGTACGTGCGTGCGAGAACGAGGGCAGTTACGCCTCATGGATCTCTCTGACATTGTGTGCGTGTGCAGCGGATCGCGAGCGGATGGTGGCG
GTGGCGTTCTTCGGGTCCATGGCGGCCATGCACTTTTTGGTCGTGCAGGAGGGAGACGTGGTCCAGCTGCAAGGGTACTTTGTCACGCGGAGTGCCCCGC
GCGATGATGAAAAGTCCAAGAAGCTCTTTGTCTTCCCCCACAAGTCAACGGGTGTCGTAAGCCTCGTGCCAGGTGCGGTGCTGTGGACGATTAATACCCA
GTGGCATCCTCTTCACACATAGTGTTTTTGATTCAGACAAGTACTGGAAGCTGCTCGAGACCATGCAAGTGCTCGAGAAGCGGCCACGCCCAACGCCGAG
CAGGGAACATGGTGACCACGACCTCCACTCTACAGTGTGGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTTTTGGAACACGCTGCACACTCGAGA
CGTTAGGATGTCAGCTGAAGAAGCTGATACGACGCACTTTGATTTCGTGGGTGTGGCGTCTTTCGTCAGCCGTGTGCATCGCCATCGCCCCCATCGCGAT
GGCTCCATCGACGCCAACACGGTCGCGTCGCTCACGGCGTATCGGTGGCTCAAGGTGATTGACGCCCACAGCACGAGCGAACTGGTCGTGCGGCTCTATG
TCAACTCGCAACCGACAGCATTCCATGCGATCCAAGCGGGCGACATGGTGCTGCTATCCAAGCTTAAATGGGTCCACCCCCACAGTAGTGGAGGGGGCAT
GGCATTTGCCAGCAGCAGCCCGTTCACGACGATCCGACTGAACGACGTTATCGAGCCATACCAGATCTTCTCCGCGTGCTCCCAAAATGTCGCATTTGCC
AAGGAGCTCCAAGCAAGCGGCGGGTGCAGAGCCCATTACTCGCCACTCGGTGGAACCACAGAGAGCTGGCTCGAAGGCCCCGCGGTCCACGACTATGAGC
CACTCCACTCCGTCATTTCGATGCTCGACTCGGTGGACGAAACGCTGACGATACTGGCAGACGAAGACTCGGCCGACGTGGACGACCCGCGGCAACACTG
GATCCCGATGTTTACCCCGGACGAGCTCGGCGTGTACCCGTTCGAAGACGTTGCGGCGATAGCTGAGTCCATGGACGCCATGTCCCACCAGTACATTCGC
GTCCACGTCGCGCTCCACGACATCCGCGCGGCGCCTAGCCACACGAAAGACGACGTCGCCGACATCGAGTTTCTCGTGACGGACAGCAATCGCCAGAGCG
AGCGCCCGCCGCAGCTGCTTCGTCTCCGGTCGAACCTGCTCTTCCGAGAGCCCGCGCTACCGAGTCCGCTGGACGAACTGGTCGCGGCCGACGCCGAGTC
GCTCGCGCGGTTGCTCACGCCGTCGGCGCTCGAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTCGACGGAGCTACCTC
ACTTCAGTCCGGCCAAGGCACCGCTCCATTCGCCGGCCGCCGAGTCGGACGAGCAGCAGATCACGCTCGCGACGGTCAAAGAGTATATCCTCAAGAGCCG
ACAGGGCGGGGGCGTCGGCGGCATTGAAGTCGCACTCCATCTCTACCGCCTGCCACAGGGTGGACTCGATCTATGGATCGACGGCATCAGTCTCGAGGGC
TAG