Transcript Name :
Pytar_ATCC12531snap_masked-par_contig_1-abinit-gene-0.56
Orientation:
(+)
Number of Exons:
1
Description :
Protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
286-336
1-262
263-285
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1011 bases(100 bases per row)
ATGGCAACAGCCACCAACTCCACCTTTGCAAGCCAACCCGAACCCGACCTGTCGTCGGATTTCACGTCGATGCTGTACGCGTTCCGCGCTGCCGGTGCGT
CACTTCCACGCATTCAAGTCTCGACGGGCGTTCCCCTGGACGTCAAGACAAGGCTTGATGCATCCCACCAGTCATTCGCAAGTCTCTCGGGCTTGCTGCA
GCGTGCTGTCTTGTGGGACACGGGCTATGCTATCGTGCGGCGACAAGAGTCCAGCACGATCGTTGACGTCGTCCCAGTGTACGTCAAGTGTGGGCTGCGA
ATGGCTGACATTGCGCCAGACCGTGCGTACTTTGAATCCACGGGCTGTTCGGTGCAAGACTGCTCCCTGACCAACAGCACCGCCACAGAGGAGCCAATCT
ACTCCTGGCGAGCTCGCGACTGCCTCCTGAACGCCGCTGGAAGCAAACTACTCGCCGTGACGCGCTGCGCCGTCCCCGCTTCGACCGATTTGCTCAACAT
TCCCCACGCGGATAGTACGACAGTGTGGGCGGTGGGCACGATTGCCGCGAGCGAGCAAGCTGCTGTGCCGCGTCTTCGCCTGCAGCAACACCCATCCTCT
ACGCCCGCCAATAAGTGGTACGCGATCCGCTTCGCAGCGAGTGAGGTCTCGCTTGGCACGTGCCCGACCGAGCCGTCATTTATCATCCCATGTGACACCG
TGGACCAACCCAGTCTACAGCAAGAGTGGTGTCGACCCGTCCAGAGCGATCTCATCTTGACGTGGCTGCGGCAGGAACAACATCAAGTGATGGCGCTGGC
GACGCTCATTCTCATGGCCGGCGCGATCCTCTTGGCGCTAGCGTTGGATCTCTTTGTTGACCGCAGACCACGACTGCTGGTGACCGGTCAAGTGGGGGTT
TCGATACCGTCGCTGACGAGTACGTTCTTTGACGGCCGCGACAATGATGCGCCAGAGGAACCTCAAGAATTAAGCGTACGAGCGGCCGAGTCTGTGCGGT
CAGACCATTGA