Transcript Name :
Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-0.20
Orientation:
(-)
Number of Exons:
1
Description :
Alpha mannosyltransferase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6510.74621
InsideOutsideTMhelix
1-804
*** None ***
PositionContextScore
428FCSRHRR|SL0.819
*** None ***
GO
*** None ***
KO ID
K07819
*** None ***
Sequence
        2415 bases(100 bases per row)
ATGCGCGTCGTGGTCGCCGCCGTGGCACTGCTCTCCGCGAGGTCGGAGCTCGCGTTGGCTGCGAAAGGTAGTGACGCTCGCCTCACAGTCGCGCTTGATG
CGGACTCGTCCACACACAGCGTCGCGTGGGACGACCGCGCTCGCGGCAACCTCCAGTTGAATCTCTCCACCACCACCAGCCGCCAAGAGCACGAGACTTT
GCTCACAATCGGTGTGAAGACCAGCGTGCTACATGGTGCTGCAGCACGGCTAGCGGTCCGGCAGACGTGGGGGCAACCCGAGCAGCTCGGCGCTCTGGGC
GTGCGAATCTGGTTCGTCGGCTGCACGCCGGACCTCTCTGACTTATCCGAAGCCGACCGCTCGAGCGCCATCGAGACCATAAATTTGGAGAAGGCAATCT
ACCAAGATCTTCTGACCCACGAGCTGCGGTGCGAGGACTCGTTCGCTGGTCGAGTGGACAGGACCATCGAGTTTATGCACTTTGTGGAGTCTTCCTCGCC
CTCGCCGACGATGCCGGCGTTTGTGATGATGGCCGACGACGACGTGTACATCCGACTTGGTGAGCTGATTGCATTGCTACAATCAGCACAACTACCACGG
GAGCGACTATACGCTGGCAACGCTGCGACGGCGGCGCAGCGGGGTACGAGCCCTCCCGTGCGAGACCCACACAGCCGCTTCTACTTGCCCGACGACATGT
ACCCCATGTCGGAGCTCCCGCCGTTCGTGGCCGGAGCGCACTACATCGTCTCGCGGGACATGGCGCAGTTTGTCGCTCGCAACCGCGACGATCTGCGGGG
CTTTGGCGGACTCGACGACGTGACGATGGCGCTGTGGATGCTGTGTTTGCAGGTGCACCCCGTGTTTCTCGACAGCTTCCAGGTCCTGGGCAATGCGCCG
TGCAATGACGGCATTATCTCGTTCGCCAACCTCTTGCCCACAGCGATGCACCAAATTCAATCTAATCTCGTCGCCGGTCTCTCGTTCTGCCATAACTACT
CGGACACCACGTGGCAGACGGACGCGTACTTGGAAGAGACGGGTGCCACGCAGCACACGCAGCAGGACGAGCGACTGAAATTTCGGTGGGACGTCCAACA
CGACCCGGCATCCATGTCGCTGCACATTCAAGTGGACGTTGCCGTCGGCGCCAAGCGTGCCGGACTCGTGTACGTTCCTTCTGCGGGCCCGTACGACGCC
GTCTTCTGCAGCCAACTGCTGGAACTCGTGCGCGTCGAGTTTGCTGCCCCAGTCGATTCGTCGTTCTGCTCACGCCACCGCCGCTCGCTGCAGGACTTTC
TCGATCAAGAGCAACGACCTTCGCTACGAGCGAAATTCGCGATCGCTCGCCACAATCTCGCGCGGGCAGAGACCGACGCCGCGTCCGGAGTCCCTTCCCC
CACTGTCACGATCGTGCTGTCGCCTATGGCACTGTATTCACGCGTCGTGGTCGAGTGTCTGATGATCCAGATCTACAAAGACCATCACATTGTTGTGATC
AGCGAAGCGGACGTCCCCACAGATGCACCACCACCGGCGATTTTTGTGTTTTCGATCCTCGATGAAGGAAGGCGAACAGACGACGAGACGTCCGATCCCC
ACGCGCTGGGCTCGGGAGCTGCCTTTGTGTACAAGTACGGCCCGACGAGTCGGCTGCTGATGGTCGCAGGCGAATCGTGGCCGACATTCAAGCTTCACCC
ACACGTGACGCTGCTGTCGACGGTCGAGACGCCGCACCACCCAAAGTTCTTGTATCTACCGTACGCGTCGTCCACGTTTGGCGAAATCATCCGCCACGAT
CCGACGCAACTGCTTCAGCCGACGCCAGCAACGTCCGAGAGGCCGAGTCGCTTCTGCGCCTATCTCTATTCCAACTGCGGCGTCGCGATCCGCGAGCGCA
TGTTTGATCTCGTCAACGCCATTGCTCCAGTGGACGCGTTGGGACGATGCCGGGGATCGCAGCGCGCACCCGACGACAAGTACTTGGCGGACCGGTACGC
GTATTTCTATAGCGACCGTGCTGTCGATTTCTACCGCGGGTTCAAGTTTGTGATCGCCTTCGAAAACACGTTCGAGACACCAGGGTACATGACCGAGAAG
ATCGTGACCGCGTTTCTAGCTGGTGCCGTCCCCATCTACTACGGCGACTCGGCGACAGTCGCCAGGCTCTTCAACCCGAAGGCGTTCATCGACTGCGGAT
CCTTCGAATCCCTTGAGGCGTGCGTGGATCATGTAAAGCGAGTGCACGTCACGCCCTCCGAGTACGAAGCGATGCGACAGGAGCCACCGATTTCCAATCG
CACGGCGTTTCTGGAGCTCTTCTCGTGGCATCCGACCGTCGCGGATATGGTCGAGGCGTCTGCCGGTGAGGTTGTGCCCCTGAGTGTGCACCTGGAGAAA
ATGCTGTTGGGGTAG