/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_bd12b2e0dc878f7ce80b081140ce6ede -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1223556 -w 120 -web -o /tmp/images/bd_log_output_file_bd12b2e0dc878f7ce80b081140ce6ede
Transcript Name :
Pytar_ATCC12531maker-par_contig_1-snap-gene-1.10
Orientation:
(-)
Number of Exons:
3
Description :
Casein kinase II subunit beta
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Casein kinase II, regulatory subunit1.4PR00472
Casein kinase II, regulatory subunit1.4PR00472
Casein kinase II, regulatory subunit1.4PR00472
Casein kinase II, regulatory subunit1.4PR00472
Casein kinase II, regulatory subunit1.4PR00472
*** None ***
HmmSmart predictionP-Valprediction_id
Casein kinase II, regulatory subunit1.2SM01085
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-304
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein kinase CK2 complexGO:0005956IEA
KO ID
K03115
K03115
K03115
K03115
K03115
K03115
K03115
K03115
K03115
*** None ***
Sequence
        1019 bases(100 bases per row)
ATGAGCAAGCGCGGCGCGCAGCGCGAGGGCGCCGAGATTGAGCTGCTGGAGGAGGAGATCGGCGGGCTGCGTCTGGGGGGCGGTGCCGACGCGGCCGGCG
GCGACGACGAGTTTGTGAGCAACTCGTCGATCGACTCGAGCGAGCTGGAGGAGGACGAGGACGAAGAAGAGCTCGAGGACGAAGACGGCGCCGAGGACGG
CAGCGAAGAAGAGACGAGCTGGATCGCGTGGTTCTGCTCGCTGCGTGAAAACGATTTCCTGTGCGAAGTGGATGAGGAGTACATCGAAGACGACTTTAAT
CTCACGGGGCTCAACACGATCGTGCCGTACTACGACTACGCGCTGGACCTCATCCTCGACATTGAGACGCCCCACGGTGCGGTGCCTCGTCGTTTCGTGG
AAGAAAACTACTACTCATTCTAATACTCATTCTAATACTTTCCATGCATGTGCAGACCAGAACCTCACGCAGATGCAGCAAGAAATGATCGAGTCGGCCG
CCGAGATGCTGTACGGACTCATCCACTCGCGGTACATTCTCACGACCAAGGGCATGGCGGCCATGCTCGAGAAGTACCAGAACGTCGACTTCGGCCGGTG
CCACCGCGTGCACTGCACGGGGCAGCCCGTGCTGCCCGTGGGCCAGTCGGACGTGCCGCGCCACACGACGGTCAACGTGTTTTGCCCCAAGTGCCGCGAT
ATATACTTTCCCAAGTCGCAGCGCGCTGGCCGTACGTTTGATTTATTGCGAGGGAGAGAAAGAGACCCATGCAACTGACGGTGGTCCGTGCTCTATAGAA
ATTGACGGCGCGTACTTTGGCACGACGTTCCCGCACGCGTTTCTGCTCGCGCACTCGCATCTCGTGCCATCGCCGCCGACGCAAGCGTACGTGCCCAAGA
TCTACGGCTTCAAGGTGCACCCGACGAGCGAGTACTACACGGGCTCGACCACGACGAAAGCAGATAGAAGCAGCCACCGCCGCGGCCGGACACGCGTGGA
CCGCATGCTGCGCAGCTAA