Transcript Name :
Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-0.5
Orientation:
(+)
Number of Exons:
2
Description :
Beta-catenin
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-558
*** None ***
PositionContextScore
33GSARSKR|RR0.715
*** None ***
GO
*** None ***
KO ID
K12864
*** None ***
Sequence
        1884 bases(100 bases per row)
ATGGACGACCACTTCGCGCGCGTGCTCGCGGGCCCCAAGCGCGCGGCTGACGACGCTGATGCGGCTGCTGACGCGTCTGGTTCCGCTCGTAGCAAGCGCC
GTCGCGACACGTCCGACGACAACCGCGCGCGGGTCGCCCAGGTGCTGGCCCAGGGCGACGCCGCGGCGCAAGAGATCGTGGCGCTGGACGCGCGCGCGCT
CAAGACCATGGCCCACGCGCTCGACAAGGCGATCCGCCGCAACGCTCTAATGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCAAGCACAGCGACGAGCCGGCCAAGTTTATGGAATCGGAGATGCAGCTCGACGAGGAGCTCA
CCAAGTGGAAAGCCGTGGCCGCCCAGCCCGCTCTCTACGCCGAGCTCGTCGAGCTCGAGGTCGTGGCGTCGCTGCTCGGGTTGTTTGGCCACGAGAACCT
GGATATTCGTCTGGACGTGGTCAATCTGCTGGCCGAGCTCACGGACGTGGACGAAGACCCGTCGGCGCTGGCGCCCACGACGCGACTCGCGACGCATTTG
GTCGCGCACGACTTTGTGCCGCTGCTCGTCAAGACGCTCGACGATCTCGACCGTGACACGCAGGACCGCGCAGAGGCAGAGGACGACGCGAGCGGCACGG
GCGTGTTCCACGCGCTCCAGATCGTTGAGAACATTGTGGACGTGCTGCCCGACTCGGCCGTCACGCTCGGTGCGTCGACGTCGATCTTCTCGGTGCTGCT
GCGGCTCGTCTCGCCCAAGCGAACGTTTGGCTCGACCAAACTGTACGCGAGCGAAGTGCTGTCTATTCTCGTGCAGGCGGACGGACGCAACCGCGAGCAA
TTCCTATCCAACACACAGGACGATGACCGGCTCGACCGCTTGCTGCAGGCCCTTGCGCCGTACCGGAAGCGAGACCCTCAGGGCGACGAAGAAGAAGAGC
TCGTCGAGAACCTGCTCAACACACTTTGCAGTTTGCTGTGTGAGACGCAGGGCCAGGACCGCTTTCGACGCCTCGAAGGACTCGAACTCATGCTGCGTTT
CATGAAAGACCGCAAGCAGTACGTGTTTTCCGGCGCCTTGCGCGTGCTGGACCACGCGCTGATGAATCACGCTCGCAACTGCGAGCGGTTCATCCAGGTC
GGCGGGCTCAAGGCGCTGTTCCCCATGTTCATGGGCAAGAAAGTCGCCAAGAAGAAAGACGTGCGCGCCAAGGAAATCGAGAATGTGACGAGCCTACTGG
CGTCGCTGTGTCTGCTGGTGCCGCAAGACGCCGACCAGGATGTCCATGCACGGCTCCACGCCAAGTTTGTCGAGAACGAGATGGAGAAAGTGGACCGAAT
CGTGGACCTCTTTGCCAAGTACTATGACCGCGTGCAAGCGGCCGTGGCGCGCGAGAACCCAGACGAAGACGAGGACCAAGAGGACGAGGACGCTGCAGCG
GACGAACGGTACTTGCGTCGACTGGACGCTGGGCTGTTTGTGCTCCAGCGGGTCGCGCTGGTGGCGGCCCATCTGAGCAAATTCTCACGCAAGCTGCGTG
CGTACGTCATGATCAAGTTCCACGAACGCAACGTCGACATCGAAGCAGTGGTCGCAGTGCTCCATGAGCAACTTAACACGCTGGAGGCCGAGGCGGACGC
GGAGACAGAGACAACGAACAGCAAAGCAGACGCGATTAAGCAGAACCAGATTCAACAGGTTCGGCAATTGCTGCAGGCCTTTGATGATGAGACGGAGATC
GAGGATGCGGCGGCCGCGGAAGAAGAAACGGGAGAAAGTGGGAGTCCAAGCGAAGCCATCAAGGAGACGGCCCCGACCGAGTAG