/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_2528b2963558aef0973d9bb1ae21d374 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/1223556 -w 120 -web -o /tmp/images/bd_log_output_file_2528b2963558aef0973d9bb1ae21d374
Transcript Name :
Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-1.0
Orientation:
(+)
Number of Exons:
3
Description :
Gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-283
*** None ***
PositionContextScore
129INDRFRR|DL0.575
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1283 bases(100 bases per row)
ATGACCGCGAGCCCAAGTGCCGAGTATGAAGAGTACGCTGTGGACGGTGGCGAGGAAGACGAGTACGAAGTGGAGGAGCTAGTGGACGACACGCCCATGA
AGATCTACGGACGCGTGTTCCTCGGTTCGATCGATGCTGCGAGAAACTGCGCAGCGCTGGTGCGCGCCAATGTCGGCATCACGCTTGCGCTGCTTGGTGC
CGGGGATGAGCGCGTGGAAAGCAGCAACGATGAGAGTGGCGACAGTGAGCGTTTGACACGTATCCTCGTAGAAATGGAGGATTCGGCGGATGAGCCTCTC
TTCACGCGACTGCCGGCGCTGCTCGCGACCCTACAAGAGGCTCTGTGAGTTGGACGGCTTCTGAAGTCCCACCGACTGCTCTGCTAGACTGACCCTGTCC
TTTTCCAAGTAGCACGGGTGCTGAGAAGCGAGATTGCAACGTGCTCGTCCACTGGTACACTTCATTTTCCCTTTTTTGGCTGGTGGGGTGAGTCGCGTTG
GCTGATCCTTTGGTGGCGTTGTGATTCGTTCCAGCATGGCCGGTCGGTCGCGATCGCCCTCGCTCGTCGCGGCATGGCTCATGGTCACGCGACAGTATAC
GCTCCAGCAGGCACTCGACCTCATAGAGTATGGTTCACGCTCATGCAAGCCTTTTCGCTGAGCGGATAGGCTGACCTTTATACTGCACTGTGTGCGCAGG
ATGGTCCGCCCGTGGATTGAGATCAACGACCGCTTCCGACGAGACCTTGACCTCTTCTCGCACGTCGTTCGATACCACAAACAGAGTGAATCGCCCGCTT
CAGTTGGTTGGACCGCAGTGCTGACGTCGCATCATCTCGCATTGTTGCCTCGGCTCGACTTTGGATCGTCCCTCGTTGCCGACATTCTCGCCCACGACAA
GACCGTCACGATGCGGCTCCTCTCTGACGTGGAAAACGACCCGAACTCAGATTTGCATCGTGTGCTGCAGCACTCCACGGTAGTCGCCACGACGGCCAGT
GACCAGGACGGGACCAACCGTGACTCCTTCGCATTCTTGCGCATCGACCGCGTGGACACAGGCATCACACTGGCTTCGATGACGCCCGAAATGGTGGTGA
AGACCGGGTCGACAAGCAAGGACCACGTCTTGAGCGTGCTCCAGACATTCTACCCCGACGTGACTCTGCAAACACCGCTGCTCGTGCTCAGTTTTACATG
CATTGGGTCAACCAGGACTAAATAAATGTAACTACTAGGACGTTAGTGCCGACGCGAGCAACTGTCTGCCGCGGAGCGACAGC