Transcript Name :
Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-0.12
Orientation:
(-)
Number of Exons:
13
Description :
HECT E3 ubiquitin ligase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
HECT65.527PS50237
HmmSmart predictionP-Valprediction_id
HECT1.2SM00119
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
48-104
160-189
273-276
324-346
1-24
128-136
213-249
295-303
370-1492
25-47
105-127
137-159
190-212
250-272
277-294
304-323
347-369
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ubiquitin-protein transferase activityGO:0004842IEA
*** None ***
*** None ***
Sequence
        5987 bases(100 bases per row)
ATGGCGGATGCCGCGATGTCTCCTCCTGAGGTCGCGCCCAGCGGCTACATCCCCAAGAACTGGAGCCAGCCAATCACAGTGACCGAGTCGCTCGTGATCT
TACTGCTACCGCTTGTCTCGCTTGCGCTCATCTACGTGCTACTGCGTGTGATCTGGAAGACGCCCGGCTCGCTCGGTCTCCCCAAATACACGCAGCCGAC
GTATGGCGCCATCCCGGAAGAGGGCAGAGAGCAGCCGATTCACGTTGTGAAGACCTCGCTCGTCGAAGAAGGGGAAGTCGCGGGCGACTACGAAGAGAGC
TGGCTCACGACCTTCGACTTTTACTTTTTGGTCGGCATGACGATCTACTTGGCTGTGCTCATTCTGCTGACGTACATCTACCAGCCGTGGCTGCTGACGT
CGGGGCACTTTTGGCTCATGCAAATGCCCAAGCTTGGCGTAATGGTGCTCGTGTCGTTGCTTGGCGGTATCGTATGCCGCCATTTCTGCGACGTCGACGA
GAAGGGCTACATCATCACGAACAAGTCGTCAAAGTTCAAGGTTAACTACACGCGGAAGCTGCAGCACTTTGCCGCCTACATGGTGCCGCTCGTCATCAAG
TCAGAGGTGTCAGGCCCACTACCGCTGGCATGGGGTGACTTTTTCAGCATGCTCGGTTTCCTGGTGTTGATCAAGCCAATTCGTGAGCACTCCAAGTTCT
TCATGCTCCAGTTCAACTCGCTTGACCGCCCCGAAGACCGTCCGAACACGCTGACGTGGATCATCCTCGGCAACATCGCGCCGGGCATGGTCATCATTTT
GTTCTTCAAGTGGCTCTTTGCCGACCAAGGCGCGCTCACGTTCATCCTTGTCTTCATCACGGGCATCGGCGACGGCCTCGCCGAGCCTGTGGGGATCANN
NNNNNNNNAGCACTTTGCCGCCTACATGGTACCGCTCGTCATCAAGTCGGAGGTGTCGGGTCCGCTGGCGCTCGCGTGGGGCGACTTTTTCAGCATGCTC
GGCTTCCTGGTGCTCATCAAGCCGATCCGTGAGCACTCCAAGTTCTTCATGCTCCAGTTCAACTCGCTTGACCGCCCCGAAGACCGTCCGAACACGCTGA
CGTGGATCATCCTCGGCAACATCGCGCCGGGCATGTTCATTCTGCTCTTCTTCAAGTGGCTCTTTGCCGACCAGGGCGCGTTGATTTTTATCATCGTGTT
CATCACGGGCATCGGTGACGGCCTCGCGGAACCCGTGGGCATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGCAGCTGGGAAGG
CAGCGCATGTGTGTTCCTCTCGGGCATGATCTTCCCGGCGCTCCAGTACGCCGACTTCCACAACTTCACGCAGGTGCTGCTGTCGATGCTCATCCTCGCG
CCGACCATGGCGTACGCCGAGGCCACGGCGCCGCACACCATGGACACGCCCGTGCTCATGATCGGCTGCGGCACCATCCTCTACGCCATCACCCAGTACA
TTTAGAGGAGCCGCTGTATCGTCAGGGTTCTCCCAGGTCTCTAAGACAGGAAGAGATTACCTCTTATGCAAATTACGCATATTACTAGGAGTAACCTAAT
TTCTTCAGTTTCGATCTGATGGGAGTTTCTGACTTCAACTTCAAGTTTCGATAAACCGATCCAGTACCGGTATCACGTCCGACAAATTGCGTTTTACCGG
TTTTGCAGTAATTATCAAAATTCACACTACGCCTTCACGGAATTTCAGCTATTGCGCCATGTTCCAGCGGGACAAGGATCTCCGCGCGGCCGGCGGCGCC
GACCGCTCGCGCGTGCTGGAGAAGGCCAAGGAACAGCGCCAGGCGCGCGCCGAGCAGCGAGAGCGGGAGATCGCGGCCCAGCGGCTGCAGACATTCGTCC
GCGCGCGCCTGGCCGTGCGACGTGCGCGCGATGCGCAGCGCCGCGACTTCGACTCCAAGGTCGCGGACATTGGTCGCCTCAAGACGATGCTCCAGCGCGA
AACGCTGCCGCTGCCCTTCGACGTCATCTTTGACCTTACGCGCAAACTACTCTTTTGCTACAGCGGCCGCAGCGGCGACCAGGCGCGGCTCGCAGCGCTG
AGCCAACTCTTCCGCGACGCGCTTGCCGGTCAACCGGCCGACGCTATCACGGACGCGCAGCTCTCCGCAGCACGCAAGTGGCAGCTCGTGTGGCTCGTCA
ATCTCTGTCTACAGGCGTCCAAGTCCGACCCCCGAGGCGCGCCCATCGCGCTCGCGCTGCAGCTCACAGAAGCCGTTGGGTTTGTGCGATCCTACGTCGT
CTCTCAGACGTTGCGCGTCTTCTCTCCACTTGAATGGCAGTATGCTCGCATGGAACAGCTCTCGCTCATGGAAATGGTGCGCCGACTTCTCTCGCTTGCA
GCGACCGTGACTGTGAGCCGAGGCGCCAGCGCCGATACTAGCAACCAGTTCTCCTCTCAGCTCGTTGCATTTGCTATCCATGCGATGACCCAGAGCAGCG
CGTTGGAAACCGCTTTCGTGGAGATGGTACTTGGCTATAACACTCTCTCACGGGTCTGCCCTCTCTCATACAGTGCTGTGTATTCTCTTCCTAGGTGCTC
AGCGTACCGCTGTTGCCGGACGTGGTCGACGACTCGTCGGTGCTGACTCGGCTTGTCGTGGATCCGCTGTGGACACGCCTGGTCCACGCCACGCAGTCGT
CGAACCTCGACCTACCACCTCCACTCACGGTGGGCATCCCGTCGATCACGTGGCTGCTGGGCAATCTTCTGTGGCTATCGGATCGGTGCGTTAGGTTCTC
TTCCAAGCCTGCGAACGATCTGACACTCACAACTATCTGTGTCGTGGTCAAGCGTTCCGACTTCTCAGCAGTCGGCCAACGCCACCCGCCAAGAAATCAA
GATGTTTACCAGGCTATTGCAGCGCGTTCCGCCCGAGACGTTTGCCCCCAGCGGCGTCGCCGTGTCGTGGACCAAAGTCTCAGATTCGCACTCGGTGCCT
GTCGTGTTCCCGGACGCCCTCAACAACCAACTGCGTGTGCTGATGAAGGAATGCCGCGTGCGGCAGATTTGCGAGTCCCTCATTGCGTTCAATCCGGCGG
CGTTACACAAGCCCCTTGCGACCGAGCGACCGACCCCGATGCACCCCATGGCGTCAACGATTCATGTACGTACTACGCACGCAGTGGCGAAGGGACAGTA
CCGCTGACTGATGGTTGTGGATGGGGATNNNNNNNNNNGTACTACGCACGCAGTGGCGAAAGGCTCAGTACCGCTGACTGATGGTGGTGGATGGGGCCAA
TATGCAGGAGCAATACGGCTTTGGTGATATCGCGTCTTCTCGGTCGTTGCAACAATCGTTCAGCGAGACCTGGCGGCGTGTGAAATCCCTCGGGAAAGCT
TCCTGGGCAAAGATACTGCTTGAGAAGACGGGACTGAAAAAAGCGCAGGAGTCGGGCGAGAGTGAGTTNNNNNNNNNNGGGAAAGCTTCCTGGGCAAAGA
AACTGCTTGAGAAAACGGGGCTGAAAAAAGCACAGGAGTCGGGCGAGAGTGAGTCGAACGCTCGCCGATCGTCTTTGGTAAACACGTCGGCTCAGGCACG
GCAACTCGCAAACGGTGAGGCACAAAGCAAGCGCCGTGCTGCTCGCCTTCCCTCCAGCAAGCGCGCGTTCGAGCTGCAGGATGTGTACGCCGTGGGCGTG
TACTTCGCGACGTTCTTGGCCCGATGGCCTCACCACGCCAAGCTCCACCAGTCGTACCAAGCGGCGTCGATGAACGTGATCAACGTCTTGTCGTTCCTTA
AGCTCTCGGTCCCTACTTCAGAAAAGTCGGAGGGTCAATCAACAGTGAACGCACAAGTGCACTTGGTCGCGGTGCTGTGGTCGGTGCTGCAAGAAGTGAA
AGACTTCGAATCGTTCTCACGGGTACGGCTGTTTAGTGATTACGACTGATCACCCTTGGGAAACACGCTGACGATGGAATGATTCATTTGCTTACGCACA
GGACGTGGATTTCCTCCACGTTGATATTAACGACGGCTACGTCGCTACGCTCACGCTCTTTTGCGCCACGTACAGCCATTTGTTGGCGGTCTTGGATGAC
GAAGAGGTGCGCCTACAGGCGTTTTTCAACTATGTAGAATGTCGTATTGACCATCGCTTTGTTCCTGTCTTTTACGCAGATGTACGACCAAGAGTTCCCT
CTGCCTCTCCATCAGCTGGAACGAATCGTTGTCGGTCTCAAACACGCCCTTCATTCTGCGTATTGGGTCCACGGTATGCGTTCAAGCCAGCCTGGCACGT
CACTGGAGCTTGGTCTCTTCCTCATCGACGCTGCGACCCGTCTGTTGTCGGATCTCTATAGCCGTTGCTCGCGGCTGCCGTTCTGCAACGTGTCCAGTTG
GTGCGTGCCATTGAGCCACGCGTTTGTATCACTACATACCTTACCGTTTTGGTTTTGTTTGCAGGGTACTGCCTGGGCTCGACAGTGCCCAACTGATCGA
CGAAGTCCTCGCGGGCACGCCGCGTGCCAACAAGCTCATCAGCTCCATGCCTTTTGTCGTGCCCTTCCCAGAGCGTGTCAAGCTCTTCCAACGTCTCGTG
GAAGCCGACAAGAAGATTCACCAGGGTGACGCGTCCACTGGCAACGCTCTGGCCGCGTATCGCGTGCGCATCCGTCGTGGCGCTGTCCTCGAAGACGGTC
TCACCAAGCTCAACGTCATCCGAGGCAACCTGAAGAAGAAGATCAATGTCGTGTTTGTGAACGCCGCCGGGCGAGAGGAGGTGGGTATCGACGCTGGCGG
CTTGTTCAAAGAGTTCTGGCTCGACCTTGCCAACTTAGCATTCGACCTGCAGTACGGTCTCTTCCTCACGACGTCCACCGACCAGCTCCTGTATCCGAAC
CCGCACGCCGCGTCTTCGCACTTCACGCGCGAATGCGACCCCTTGACGCTGNNNNNNNNNNTCCTGTATCCGAACCCGCACGCTGCGTCTTCACACTTCA
CGCGCGAAAGCGACCCCTTGACGCTATTTCAGTTTGTGGGCCGCATTCTCGGCAAGGCGCTCTACGAAGGCATCGTCGTGCAACCGAAATTCGCGCAGTT
CTTCTTGTCCAAGCTCCTGCACTCGTTCAACCATCTGAGCGACCTGCCGTCGTTGGACCCGGAGATCCATAAGGTAGGCTCCTCACACTCTTGTCTGCAC
TATGGAAACCACTCTAGAGTTTAACGATGTTTTGTNNNNNNNNNNTGGACCCGGAGATCCATAAGGTTGGCTCATCACACTCATGCCTGTATTATGGAAA
CCACTCTAGTGTTTAACGATGTACTGCCGGCAGAACCTCATGTTTCTCAAGTCGTACGATGGCGACGTGGAAGACCTCGGCCTCACATTCACCGTGGTCC
ACGAGTTCTTGGGCGAGCAGCGCGAGATCGAACTGGTGCCCAACGGCGCCAACGTGGCCGTGACCAGTGCCAACCGCACGCGCTACGTGCACCTGGTCGC
CAACTACTACCTCAACACGCAGATCCGCGACCAGAGCAAGGCCTTTCGCGCCGGACTCGCCGATCTCATCGACGTGCGCTGGCTCCAGCTCTTCAATGAG
CCCGAGCTGCAGGTGCTCATCTCGGGCAAGAGCGGCGACATTGACGTCGCCGACCTCCGGGCCCACACGACGTACGCCGGCGGCTACTTTGCGCTCGACA
AGCGCGTGCAGTGGCTCTGGCAGGCGCTCGAGAGCTTCTCGCCGTCGGAGCGCGCGGCGTTTCTGCGGTTTGCGACGAGCTGCCAGCGCGCGCCGTCCCT
GGGCTTTGGCGCCCTCACGCCCACGTTCTGCGTGCAGAAGATCCCCATCCGCCGCGACGACGAGCTGCTGCCGAGCTCGTCAACGTGCTTCAACACGCTC
AAGCTGCCGACGTACTCGTCCTTTCGCGTGCTGCGCGCCAAGCTGTTGGTGTCGATTTCGTCGGGCGCTGGTTTTGAAATGACGTAG