Transcript Name :
Pytar_ATCC12531maker-par_contig_1-snap-gene-0.33
Orientation:
(+)
Number of Exons:
4
Description :
Alpha 1,3-fucosyltransferase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain5PS51257
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4890.68919
InsideOutsideTMhelix
1-913
*** None ***
PositionContextScore
312RNRRENR|SF0.678
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3224 bases(100 bases per row)
ATGCGCGCCTCGCTGACGCTGGCAGGAGCCGCACTCGTCGCTACCGCCGCTTGTGCGTCCCCATTCGTACTCTTTGATGCGCCGTGCCCGCGCCTAGAGA
GTGATGGTGGTGCGCTGTCGCGAATGATGCCAGTAGCAATCGCCGTGGAGCCCTCCGGCGCGCAATCCAGAATTGCACACGAGCTACCATCGACACGGCT
CCCAAGTGTAAGCGCGGCGCGGCTACTCATCGGTGTCAAGTCCGCAGCCATCTCGGGTTTCCAGGGCCGCCAGCGGATCCGGCACACATGGGTGGATGCC
GAGATGCGACCGGCTGGCGTTTCCGTTGTGTTTCTCGGATGTGAACCCGACGAGACGTCCCACAATGACCCAGCCGAGTGGCGACAAGCGCTAGACCGTG
AGAAAGCAGAATACGGCGATCTGCTCACGCACGAGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGGGATTCGTACTGGACGCTTGTAGAC
AAAGTCAAGGGGTTTCTGCAGTGGACAGACGCCGCTGCGCAGAGTGGTGTCTCGAACCTCGCGTACGTGATGATCACAGACGACGACGTCTACGTCGATC
TCCAGCAACTCACTGCGTTAATCTTTGCCACGCATCCTCCCGCCGTCCCGCGTCGGCGCTTCTACGGTGGCCAAGTCATCCAAACCCAGTTTGGCACTGC
CATCCATCCATTGCGCGACCCGGCCGAACGCAATTATCTCCCGCATGAGAGTTACCGTATGCACGAGAAGCCGCCTTTTGCGACTGGCGCGCACTACCTC
TTGTCGATCGATCTCGTGCGGTTTCTCGCTCGCAACAGTGACGCGCTCCACGGCGTCGGCACGCTGGAAGACGTGAGCGTGGCGTTTTGGTTGTTGGCAC
TACTGAACGTGCGTCCCGTGCACATGCTGCAGTTCGACAACGTACGCTACAGGCTGTGCCATAACGATCTCATCGCGTACGCTGATCTCTCGCCGCTAGC
CATGCATCGCATCTATCGGAATCGAAGAGAGAACCGCAGCTTCTGCGAGGGGTTCTCGGCACCGTTGTGGGACAAACGCGGACCAGAACGCCTCCTCTCG
CCACAGCTTCCCGAGTCGTTTCTGGAAGGAGGCTTTCGACTCCCACGGCCCTTTCGTTACCAGTGGGATGCCCAAGTCGCCGACGCGGCCAGTGTGCTCC
ATCTCGTGACGACCATCTCCACGGACGACAACGGCACCAGGGAGAAGGCGGTCGCTGTGTACACACCCGCGAAAGACTCGCTCGTCGTGTTCTGTCACGC
GCTGCTCTTGGAAGCGCAGATCAACATGCCGACAACAGCGATCCCTCGCGACTATTGCTTGGAGTACCGTACGTTTTTGTCAGAATTTCTCGCATCTGTG
TCGTTCGATGCGCCAGCGACGAGCCCGAAGTACGCGCTGGCACGCAGCAACCTCCTGGAAGACTCACTAAGTATAGCTGTATTCGTCCAGCTCACGCCAG
GCGGCTCGGCGCGAAGGACTCTCATAGAATGCCTTCTAGCTGCGGCGCTCACTGGTGTCCATGTTTCTGTGCTGGAGACGGCTGAATATGCGGAACGGTT
AGGTGCGATCGCTCCGGATATCATTTTCACCACGACGGCAGACGCAGTCGAGGAACGTGCAGCAGTAGCGTCCAGAGTGATTACATTCCGAGGCGTTGAC
GACCAATTCCCGAGCGACGGCAGCATCTCCTGTGGACATACGATTGAGATTTTAGCGGTCCGAGCGGACCCGCACNNNNNNNNNNCTCCCGAGCGACGAC
AGCATCTCCTGTGGACATGCGATTGAGATTTCAGCGGTCCGAGCGGACCCGCACTGCCGACAACTCTACATCCCGATCGCCTCGCAGTCGTTTGCTCGAC
GTCAAGCCCACTCTCCTGTCGCTTTGCTTGAAGCGGTCAACGGCACAGACATGGGGCGCGCTGGAACCGCGCTTTTCAGCTGCCGCAAACAGTACACGGT
CGCGTCCACCGCCGCCGACGTGATCAGTCGCTATCTCCGAGGCGAAGGCATCGCCATCGATACGGATTTCTGTCAGCATAGCGATTCAGCGACACTCGAC
GACGACGTCGTGCGCTTGTCCAAGTACAAGTTTGCCGTGGTTGTGGAAGACCGTCCTCTTATGGCCGGCCACGTCTCAGACCAAATCGTCTCGGCGTTTC
TTGCTGGCGCCATTCCAGTCTACTATGGACACTCGCCCACCGTGATGTGGCTCTTCAATCCGCGCGCGTTCATTGACTGTGGCTCGTTTCAGTCTTTACG
AGCGTGTGCACGCCATGTCCGCTTCGTGGCCGAGACGCCATCGGAGTACGAGGCTCTGAAACACGAGCCGCCGGTCGTGAACACAACGGCCTTCGTAGAA
ATCTTCTCATGGCACCCTCACGTGATTGAGACGGCGGGGCGTGAAGTTCCTCAGTCATATCTCCTTAGTCAGCGGCTGCTCACACTCATCAATAACAGCT
AAGTTGCCAAGCTCACGTATCGCAGATATCTTTCGAAACTTCTGTATTTTCAAGGCTCTCTGGTGCCACTTGATCTTCTTTGCGGGTCACGCATACCCAA
CGGGCCAGCAACAAGCGGCGGCGGAGACACTGGTGGTTCGCCGTCGTCCTCATCGCCGTCCACTCTCGCGTCAGCGCGTCCGAAACTTCTCTGACTCGCA
CGGCTCCGTTCTCCACAGCAGCAGCGACAGCATCCTTAAGGGCACCCGCAGGATCGACGCCCAAGTCCAAGGAGCACGTCTGGCAGCCGATCGAGACAGA
AGATATCACACGCGCCACTACGTCTACAGTTGGAGACCACGACGATATCGATGGCCATGATGACCTGCAAACGTGGGCAACAAAGCGGCATGCTGCCCTT
CAGTTCTCACCACCAAAGCTCGTGTGCGTCGACTGCTTTCTTATCGTCGGTGTCAAGACCCGTGCCATCCGTGGATTTCAAACGCGCCAGTTGATCCGTG
CAGCGTGGGTCCAGCCCTCCATCGCATTCCCTCTCCAAACGCGCGTCGTGTTTCTTGGTTGCGCACCGGACCTCTCGCAAGCACGAGACCCTGGCAATGA
GACGTTGCGCGTGCTCGCGCTCGAGAAGCAAATGTTCGCCGACCTGCTCACGCATGAGCTCGGCGGGTGCGTGGACTCGTACTTTCGTCTCGTGGACAAA
GCGCTCGAATTTTCTACTGGGTGA