Transcript Name :
Pytar_ATCC12531maker-par_contig_1-fgenesh-gene-0.18
Orientation:
(-)
Number of Exons:
4
Description :
UPF0171 family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-868
NN-scoreoddsWeighted Score
0.5841.8810.004
PositionContextScore
27WRERLPR|RV0.564
107YRARRRR|EE0.561
660YQVRPKR|SL0.609
663RPKRSLR|ST0.601
TypeScore
nuclear391
GO
*** None ***
*** None ***
*** None ***
Sequence
        2939 bases(100 bases per row)
ATGGGCGATGCCAAAGGAGCACGCGTGACGCTGGCACACCACAAGGCTGTGGTCAAGAGCTGGCGCGAACGGCTGCCACGTCGCGTGGACCACGGCCACG
CCTACATCTCACGTGGCGTCCCAGACCATGACAGAATTGATACTGCCTGGCAGTGGCATCTCAACGCACTCGACCAGTCGCGAGAGAACACTAGCACGGT
AAGCGAGTCGGTGGCCGAAACAGACGAAGTCCTCTCTGATCCCACGCACGCCGACGCGGAAGCGCTCCATGTCAGGAGCGTGGGCGAGATCAAGCACGCG
TACCGAGCACGCCGGCGCCGAGAAGAGGTCGAATGCGAACGGAAAGCGATCCAGAGGCAAAACGAGAAGCGCCCAGTTCGACAGGCAGATACCAAGATGG
AAGCGCAAGGCAAATTGCCAGCCTCCACCAGCACTCAGGCGTTCGACCGCGGACTTGAGCCAGAAGAAAGCGATCTCCCTCCGGACAAGACAGCCAGCGA
CAACGACTGTATGCCCCTGGACGCCCAACTCCTAATGACGAGTGCTGAGTATCGCGCAGACGTTTTGCGAGGCGTCCGCCACCAGCTCAGCGCCGGCCGT
GCCGTGGTCATCGTCGTCCACATCTCGGCTACCACGCCGCTCGCTGACGTCAAGCTCGTGGTTCAGCAGCTCTGTAGCGACAGTCTCCTATTTTGCGTGC
GGGACCAGAACGTGCTACCTTTGGTCGACCACGAGCACGGCACTGTCACGCTGGAGCTGCGCGCTCGCCATCCAGAGGCGACGTAAATGGGTACACACAC
CATCACTCCGCACTTACCTGAGCCCGTACCTAAGACACTCTAGCATATAATCCTTCCAGGCACTTCTCGACCTCCAGCATTCTATATTCCGAGCCCCATC
ATGAACCGCAGCCTGGGCGCCGGCGACTTGCTGGGCATCGCGCTCGTCGTGGACGACATCCACAAGGGATGCAACCTGGCGTTCCGGTACCCGGCGCCGC
TCGTGTCCGCCGCGCAGGACCACGTCTCGAGCTTCCACAAGCTCAGTGCGCCACTCATCGCCAAGCTCTTCCGCCCCAAGAACGCGCTCTGCAACGAGAG
CTTCGAGCTCGTGATTGACGACCTGCGGTTCGTCAGCCACCCGGTACTTGTGCCTCGCCGCGTCAGTAGCAGCTCCGCGGCGGCAGCTCCTGGTTCCGCC
GTTGGCTCTCTACCAACGCCGCCCACCGGGACGTTGATGACGGCGCCCGCGCAGCTTCCGACGGCGCCGTCAGCATCCACAGCCACGACGGCCAACGCAA
GCGCCGCAGTGCGGGAGAGCGACACGACGATGTTCAACATCATTTTCGTGCTGGACGAGCACCGCCAGCAGCCGTTTCAGCTGCGCCAAGCGGCCGACAC
GATCGGCGACGAAAGTGCGAGCGGCTCCGACGGCTCTGCGACTGGCGGTTGTGACAACCAGGCGCAGCTGCAGCAGCACAAGCAGCGCATTGCAGCGTTT
CGCACGATCGCGGCGCAACTCGCCAATGGGCTTCTCCACGAGGAACTCCGCGCGGGCTTCGTGTCCCGCGAAGTCCGGGAGCTGCTCCACATTCGCGACG
AGCTCTTGCAGTACGAGCGCACGCTTGCCGCATCCAGTGGCAGCAGCGGCAACGGCAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGCGCGAGCGGAGGTGGTGGCAACAATCAAAGCGGAGGCAGCGGCGGCGGTGGCGGCGGCACGAGCGCGAAAGACGGCACCGAAAATGCAAGCCACCA
AAGCGTCCTGGAGGTGGACCCGCAGACCGTGATTGACGTATCACTGAGTAAAAGCGTGCTCGCGAACGATCTCAAGAGCGTATTTCACGGTCTCGAAGCC
AGCGGCACGGTCCACGTCGTCATCAACCACTGGGTCAAGCTGTCGCTCACGCTCACTGATGCCGTGTCGCTCAAGATGCAAGACTTCCGGCCCTACCAGA
CGCTGCTGCTGCTCACTGATGAGGACGCCGTCCTCAATGCGCTGCCCGCGGACCACTCCTACCAGCTCAGCGTGTTGATCAAGGCCGCGAGCCCGCTCAA
GACCTTCCAGGATCTCGCTCTCGAGACGTCGATCCCGATCCACCAGCTCTTCCGACTGGCGGCGCATCTTGTCTACTGGGGCTTTGGCCGCGTCGTCGAC
ACGATCACGATGCACAACTTCTACCAAGTGCGTCCCAAGCGGTCGCTTCGGTCCACGTCGGCGCTCGCGCTCGAGTTCAAACGCACGTTCCCACCGCGAG
AACTGTGCGAAGTGCTCGCGAGTTTCAACGGCGCACGCCGGCTCGGTGACTCGGTCAAGAATCTTGGAAGTGCGCAGAAGATGGAGTACATTCACATGCT
GGTGCGTGGGTCTGCTGTGTGCTCTGGTCTCTTCAATCGGTTCATACTGACTCTATGCCCACTGTCTGTAGATCTGGCTGCTGCAGCGTGACTTTATCAT
GCAGTTGCATCGGTACGTCTACTTTATGATCCCGCCGGAGCAAGACGCGCCGCCCGAGCGGGAGCGCGACGACCCGATCGACGACGAGGAGAACTACACG
TTCGCTGCCAGTAACCGAGAGTACCGCACGCGAGACAGTCGCTCGTATAGCCAGGCGTCGGCGTATGGAGGTGGCAGAACGATTGACCAGCAACTGTATG
GCAAGTCGATCCCACCGGTCAACACGACAAGCGTCGGGTTCTCGGACCAGGAAAAAGCCTACTTGGACCGCATCGCGACGACGAACCCAGTCTTTACGCT
CTTCCGCAGGCTGTGCGTCTACTTTCACGGGCAGTACCACCTCGAGGAGATCATGTGGCGAGAAAATGTCTCGAGGAGCGAACTACGTACGGTGCTGAGC
ACGTACCAGGGGATCATCGTGTGCTGCCTCCACGAGTAG