Transcript Name :
Pytar_ATCC12531maker-par_contig_1-snap-gene-0.31
Orientation:
(+)
Number of Exons:
2
Description :
Alpha mannosyltransferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-692
NN-scoreoddsWeighted Score
0.5881.5290.003
*** None ***
TypeScore
cytoplasmic565
GO
*** None ***
*** None ***
*** None ***
Sequence
        2229 bases(100 bases per row)
ATGGCTTCCACTCAGCCTCCCATCCATGAGAACCGCACGGATAACTTGCCAGTGTTTCTCGTGATTGGCGTCAAAACCAGTGTGCTCCATCACTTTGCTC
AGCGCCAGGCGATTCGCCAGACATGGGCGAACGCGACAGCACTTCACGACATCAGCGCACGTGTCGTATTTCTTGGCTGTGAGTCGGATCTCACCTCCTT
CACTGATTCAGCTGAGCGAGCGTCCGTCGTGCGTGCGATTGCGGCCGAGAAGCGGGTGTACGGGGATCTGCTCACGGGTGAGCTCTATGGCTGCGTCGAC
TCGTACTCGCAACTGCTTCGCAAGGTTGTGGGCTTCATGGAATGGGTCGTGGCGACGCAAGCGTCACATCATTACGTCATGGTCGTTGACGACGACGTGT
ACCTGCGTGTCGATCGTCTCGTAGAGATGCTCCGTCGGGATGACACGCCTAAAGATCGATTCTATGGGGGATACGTCTACCAAGATCTCCAGCCGCAGAG
GGATCCCGTCCACAAAAACTACATCCCAGAGAGGGATTACCCACTGTCAGCACTACCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
CCGCACTACGTTCTGTCTATTGATATGGTGAACTTTGTCGCTCGAAATCGTCACGAGCTCCGTGGGTTGCGTGGTCTGGACGACGTCTCCATCGCAATGT
GGCTGCTCGCGCTGGGTGTCCACCCCACACACGTTCCAGAGTTCGTCTTGCTGCGAGCGACGCCATGCCACAGCGAAGCCATTGCATTGGCGGATCTCTC
GCCGGAGTCCGTGCGTCGGCTGCACTGGAACGCGGTCCACGCACAAAGCCAGTGTGACGGGATTGGCGCCACATCGGCCATTCGTCACCACCGAGGCATC
GTGCTGCCAGACGATAAAGCGGATGCGAGCGACACGTTGTTGACGTGGGAAATACTCCACGATCCGACCAGAAATGCTCTCTTCATCGGTGTAGCTATCG
CCGTCGCGAATCGCGAGGTCACGTACGAGTTTGTACCAGCCAATACGCCTTATGAAAGTGGTCTGTGCGCGACTGGTGCCAGCCTGCTTCGCGCCAAACT
GTACATCATGGTCGGAAGGGCGTTTTGTGAGTTCCATCGCCGAAAGCTACACGCGTTCATCGACCAAGCCATCCAAGAGGACGCTCGCTTAGAGGCGATG
CTCACGCTGCCTCGCCACAACCTTTGGGCTCCGGCTGCTGCTGTCATCACGGTCGGGCTATCCAACGGTGCCAAGTCTGCACGAGTTTTCATCGAATGTC
TGATCGTACAAATGTACCCAGCGGCTCGGATTCTCGTGTTCAATGAGGACGGATGGGAAGGTGCATCGCCCGATGTCTTCGTCTTGTCCATTCTGGATAC
TGTTAAAACTGAAGGCATTTCCAATGGAGCGCGGCTCATCCACGTGCACGGTCATCACAGTCGGTTCATGATGCTCGCCAGTATAGCGTGGTCACCGCCT
AGGTCTCTGAATCCCCGCGTCACGTTGATCACGACACTCGAAGGAAGGACCCATCGCAAGCAGCTCTATCTCCCCGCTGCTTCGACTATGTTTACCGAGA
GTATCCAGCACACACCGCTCGAGCTCCTACATCCGTTCACCGACCCGGATTCCTCTAGCAAGATGGAGCGACATTTCTGTGCGTACTGCTATATGCAATA
CGACCCGCTCCGTCAACAGCATCTAATTGACCTGCTCAACGAGATCGAGACTGTGGATGCACGGGGGGTATGTCAACGTAACAGGCAAAACCCACTGTCG
TCACCAACTGCGGACGCGTCTAGTGAAACCTTTGACGCCGTGATTTCCCATTACACCACGTACAAATTTGTGGTCACGTTTGAAGACGCCGTTGCTCCTG
GATACGTCACTGAGAAGATCGTGCAGGCCTTTCTGGCCGGGGCCATCCCCATCTATTACGGCCATTCGGATACTGTGATGCAGCTCTTCAACCGGGACGC
ATTTGTGGACTGTAGCGCCTTTGCCTCGCCGCGAGAATGTGCTGAGCACGTGCGGGCCATCCACGAGTCGCCAGCAAAGTATCACGCCATGAAGTCAGCG
CCGCTGGTGAGTAATCGAACGGCGTTTGTTGAGGCGTTTGGCTGGCACCCAGTCGTCATGAACGCGTTGCGTAATGCGTCTCCAGTCCTCTGGGTTCAGC
AACTCAAGCAGCTTTTGGAGAACGACTAG