Transcript Name :
Pytar_ATCC12531maker-par_contig_1-snap-gene-0.28
Orientation:
(+)
Number of Exons:
4
Description :
ENSANGP00000018727
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-381
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1503 bases(100 bases per row)
ATGGTGCTGCCGCCCGTCATGCGGCCGACGCTGCGCCGCCTCGCGACGCCGCTCGCGTCCCTCGAGCCGCCGCTGGTCCACCCGTGGGGGCTGCTGGCCG
TGATGCTGCGCGTGCCGTCGCGGCTGCTCGACCGGCTCACGGCCGCGCATCACCGGTACCTCGACCACGTCACTGCGCGCGTGACGCAAAACCCCGTGCT
GTTCCCGCACGGCTTTTTCTGCGACGGATGGGGCGATCTCTCGACGCCCTCGCGACTCCATCAGGTGCTCCAGAGCAAGCGTATGGGCGAGATCAACCCG
CTCCGTGAGAGCGACATTGCGTGGGCCGCGCCGCGCACGTTTGCCAAGGCACGCGCGTGTGTTCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTTTGCGGTGATGTAGTCCTACTGCCCGGCACTGGGGAGCACGGT
TTTCTGCATCGACGGACGTCCATTGGGATTCCACTCGCACAACGTGGTGTCGCAACACTGGTACGTTTGAGTTCAACGGGTTCCGCATGATGACGGTCTT
GAGGTGGGTCTCACCTCTTCGTACTGACAGATCTTAGAAGGCCCCTTCTACGGACGCAGACGTCCTCAAGACCAGAAAGGTTCCAAGCTACGGCGGTGCG
TCTTGGCGGTCCCAGCACCGGTATCTCTGCCTTCTGGCTGACCGTGGCTCGTTTTCCATTGAATTCCAGAGTCTCGGATCTCCCGATTCTCGGTCAAGCC
ACCATCGAAGAAGCCAAGTCGCTTCTGTCCTACTTTCAGCAGCAACATGGATACGAACACGTGGTCGTCGCCGGCAGCAGTATGGGCGGTCTCCACGCCG
CCATGATCGCGTCTGTGTACCCTGGGGACGTCGGCGCCACGGCGTGGCTTGCTCCGCCGTCGGCCATTCCCGTGTTTACGGAAGGTTTACTCGCAGGATC
GTGCAATTGGGCATCACTCTACAAACAGCACGAGCTGCAATTGCTGGACAATATGCTCCAAGGCCACGCCGTGTCCACGGCGTCGCCCGTCGAGGCGTCG
TTCCAGGACGAAGACTCCGTCCAGCAGGTCAAGAAACGCATGCGAAAGTTCCTCTCGATCACCGACATTGACAATTTCCAGCCGCCACGCCGCTCGGACG
CCATCGTCTTTGTCGTGGGCACCGAGGACCAGTACATTGGCATGACCAATGCCGAGTGGACGCGGCTCGCGGCGAAATGGCGGCCGGCAGAGTTCCGCTA
CGTCAAGACGGGGCACGTGAGCGGCATTCTCTTTGAAAGCAAGGCCTTTGAGGAGACGATCATGGACGTCGTACACAAGCTTCACGGGTCTGCTGGCCAG
TAG