Transcript Name :
Pytar_ATCC12531snap-par_contig_1-abinit-gene-0.145
Orientation:
(+)
Number of Exons:
7
Description :
Protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Cyclic nucleotide-binding domain20.962PS50042
Cyclic nucleotide-binding domain15.744PS50042
Cyclic nucleotide-binding domain9.594PS50042
Cyclic nucleotide-binding domain8.604PS50042
HmmSmart predictionP-Valprediction_id
Cyclic nucleotide-binding domain3.7SM00100
Cyclic nucleotide-binding domain7.8SM00100
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Cyclic nucleotide-binding domainIPR000595
*** None ***
InsideOutsideTMhelix
1-679
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2675 bases(100 bases per row)
ATGCCCGTGACCGCCCTGGGCAGCGCAGGTGGCGGTGGAGGCCACGAAGCCTCCTCTTCCGCCACTGCCACGGCGTCGTCGCTGCCNNNNNNNNNNNNNN
NNNNNNNNNNCAGCCAGTCCGCGCACTGGAGGGTCCGCACCGTTCAAGAGCACAGCATCCAGTCGGAACGTCGTTGCCACAGCGACGACCTCGGACTTTG
ACCGCAAGCGTCGGCTCATCCGTCGCGTGCCGCTGCTCAAGCAGTTGGTCATCGACCAGCTCTGCACCGAGGAGCAGCTCGCGACGGCGCTCAGCGCCGT
GAGCTTTGCCGACGGCGAGTACATTTACTGCCAGGGCCAGGCCGAGCGCGACCTGTACTTTATCGAGGACGGCAAAGTGCTCATCACGCAGCGGCCCGAG
ACGAGCAGCGGCGGCATGGCGTCCGTGCTGAGTGCGCTGGCGCTCGGGCCACGGACGCGACGGCGGTCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGGACGCCGAGTGCGAGATCCAGATCCACACACTCCACCAGGACGCCTACTTTGGCGAGCTCGCGCTGCTTCAGAACCAGTGCCAGCGCAA
GAGCAACGCCGTCGCGAGCGGCGCCGTCCAGTGCCTCGTGCTCCCCGAGCACGCGTTCGAGACGCTGCTGCGGCCCGTGCACTCGCTCATGTTGTACCGC
CACTTGCTCCGCGTGCACGGCGTCTTGGAGAGAGACCGCGTCTTCAAAGAATGGACGCCCGCGCAGCGACAGCACCTCATCGACCGGTGCAGCCTGCAGA
CGTTCGGCGACGGCGAGCTCATCTGCCGCCAGGGCGAGACCGAGAGCGACCAGTACTTCATTCTCGTCGAGGGCGAAGCCGACGTCGTGCTGGACGAGGC
CACGTCCGTGCTCGGATGTGAGACCGTGGACGGGCAAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGCCACGTCGGTCGTGGCACGCAAGTCCATC
TTCCAGGGCTTTGGTGAGATGGGACTGCTGGGCAAGCCCCGCACGGCGTCGGTCGTCGCTGTCGGCTCGAGTGTGCGCTGCGTCGTGATCACTCGGGCCC
AGTACATCGCAGCGGCGCAGCTCACGGGCACGGCGTTGGCACTCGACGTGGACGCCGAGGCGCTGCTCGCGACGACGCTGATGGAGGAGTGGAAGCTCGT
CATCAGCGCGCGCCACCTGCGCCTATCCAACCCGCAGGTGGCCCATTACTTGGTCACTTTCATCAAGAAGTTCAAGGCTGCGTACCACCAAAAGTTCGCC
GGCAAGACGCTGTACCTTGACCTCTTTCGCCGGCTCCACCAGGAGCCGTGGCTCGCCGACGAGTTTGCGTTCGCCTCGGCGCGCATCACGTGGGACTCGC
CGGCGTCGTCGCTCGGCATCATCCGCTCCGAGACGCGGCGCGTGCTCACCAAAGACTCGGCCAGTCGCACGCCCGACGAGACGGCGTTTGTCGCGCGGCT
CATTGAGCACACCGTCTTCCTCTCCAAGTTTGACGTGCCCGGGCCCCACATTGACCGCTTCAAGCTGGCGCGGTGTCTCGCCAAGTTCGTGGCCTTTGTT
CACATCACCAAAGACGCATACCTCTTTCGGCAGGGCAAGATTGAAAGCCGCGCGTTCGTCATCTTGCGGGGCATGATCAATATTGTCAACGAAGACGTCC
TGCCCACGGCCAGCAGCAGCAATACCAATGCCAACGCGAGTGAGAGTGGCAGCGGCACGAGTCCGGCTATGATCAAGCACCACGAAGTGATCGCGACGCT
GTCAGCAGGTGACTCGTTCGGCGAGCTCAGTCTGGTCACGCGGCTCCAGCGGTCCGCCANNNNNNNNNNNNNNNNNNNNNCATGGCGGCGTGCGACACGG
ACCTGCTCGTGTTCGACCGCGACCACTTGAAGGCGGTCGAGGCGGCGCTCCCGGGCGTCTCGGTGCAGCAGCTCATGGTCACGCGCGCGGAGTTTCTGGC
TCGGCTGAGCTTTTTCAGGGGCAGTGACTTTGGCCAGTGCATCCGCGTGGCCCACGACGTGCACGAGGGCGGGTACGACGCGCGCCACTTGTTTCTGCAG
GATGCGGTCCACCAGCGCACGCTGTACATCGTCAAGAGCGGCGAGATCGGCGTCTTCATGAAGGTGAAACTGCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGATTTCTTCTCCGCCCTGCGCCGCCAAGCAGGCGCTCGTGCGGGTGGCGACCATTGGCGCGCAGGA
ATTCTTTGGCATGGCGATCGCGACGGCCAACTTGGGCGGCGCAATGCCGACGCCGACGGGCACCAGCACGACCACGACCTCTGTGGGGGTGCCTATCAAG
AGCGAGCAGTACGATCTCGCGGCCGCCGTGTACATGAGCACGACGCGCGTCGAGATGCTCGAGCTCTCGGAGCGCGGCTGGCGACGGCTCAGCCCGCAGT
GCCTCGCCATTGTTCGCCACGCACTGCTGGAACGCCACAAGTGGAACGACGCCATGGCCGCCAAGCAGCAGCAGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNCCATGTACTACCACCACGACAAGCCCTGGCAACCGCTGCCAGCCAGCACGTCCAGTAG