Transcript Name :
Pytar_ATCC12531maker-par_contig_1-snap-gene-0.35
Orientation:
(-)
Number of Exons:
4
Description :
HECT E3 ubiquitin ligase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1069
NN-scoreoddsWeighted Score
0.6742.6030.005
*** None ***
TypeScore
endoplasmic reticulum444
GO
*** None ***
*** None ***
*** None ***
Sequence
        3456 bases(100 bases per row)
ATGGAGAGCGGGCGTATGCCGCCGCGATCGCTGCTTGGCCTCTGGCGGGTTGTGGCCGATTTTCGGCGACGATTGGTCGCTAAGCGGACCGCAATCAAGA
ACTCCCAGCCCCCCATCGAAACGTCTTACGCGATCACCACGCTCCACCGCACGCTCTGTGACCGTTTGCACTTGCTGCTGCTGGTGGTCGTGGGCGAAGA
AGAAGAGCATCGCCTGTGCCTTCTCGACGGAGGGTTTGTCGCCTCATGGGACCCAGCATTTCTCTTCCGTGCGTGTATAAGGACAGACGCGTCGATACCG
TGTCTTCGTGTGCACATGAGCGCGCGCTACGGACATTACATGCTGCCGTTCCTGCTCGCGTATCCGACAAGCTGCTGGCGCCGTGTCCGAACGCTCTTCC
ATGTCGTCGTGCGTTGGAAAGCGGTCGTCACTGCTTCTGCTTCGATTGGCTCGAGCCCTCGCTCAGCAGCGGCACTCGAGTTCGTTACAGCTGACGACAC
AGAGATTGGTGATCTCCACCGATTTGCACTGGCGCTTCTCATCGAACCGTCTCGACAGCTCAGTTGCGCAACACGCGGGTACGAGATTNNNNNNNNNNGA
TTTGCACTGGCGCTTCTCATTGAACCGTGTCGACAGCTCAGTTGCTCAACACGCGGGTACGAGATGTTGTGGGAGCTTGTTTCGATGCCGCTTCTCGAGT
GTGTACGCGTCGGGATGCTCCAGCACGTTTGCCACGAAGCGACCACCACGCCAGACGGACCGTTCGGTGCTCCGATCCGGCGAATCGCGCACTATGCGTA
CCGCGAGATGCACCGTACAGCTCAAAATGACTTTATGACGGCGATGTTACAGTTGATGGTGGAAAAGGCACGCGAAATGGACGAGTTGGTCTTACCCGCC
GACGCGCACCCGCAACGAGATGCGGCTCTGCGGGTGCTGCTCGTACTTCTGCGTTGTGTGAGTCTCGTGCGCTTTGATCCCGATCAGTACGACTTCCTCA
ACGACGTGGGGTTGGTTCAAGTGCTGGATGAGATGTTGTTTGGGGACCGCGACGACTTCGACAGCGCTGCTGAGAACACAAACGGTCGCAAAGATAGTAT
ACGAGCAATCACCGTACGTGACAAGAACGACACGCGAGNNNNNNNNNNNNNNNNNGAAGACGAGCCGCCGGTACAGGCAGTGGTGTGGGCGCTGATCCGC
GTCATCAGTGTGCACGTGAGTGCGTCGTCTGTGGCGCCGTCAGTCCCCGTCTACCCAGTCTGCTATGACGTGTTTGAGACGCTGTTCGCGAGCGCTCGGA
GCATGATGCTGCAAGGGGTTCCGTCGGCGGAGATTAAGCAGCCTTCGCTACTCGAACGTGCACGCCAAGCGAATGGCGGCGGGTCGATCAACAGTACCAT
CCGGCGAAGCTTTGAGATTCTCGTCGCGCCCAAGCGGTTCTCCTATCTGACCAAGGGCTTGACGTTCACCTACATGCAGATGCTTGAACCGGCGTCGGGG
CTGCTTGCCATGTCGCCACTTGTCAAGCCAAGCGAGTTAAGCATCACCATGTGGATCTACGCTGCGGCGGTGCAGGGCTCGGAGGCGTCAGGTGACCACC
CAATCGGAATCGCGGAGGAGAAGCAGATCGTATTTGTGCGTGGCGACGCACGCACGATCGCACCGTACCTGTTGCTGGTGCGAGACCGCGACGACAAGTG
GCAGGTCGAGGTCGGCGCGGCGGCCCATGTTGCATCTTCCAGCTCGCTTCCATCAGCAGCAACTCGGCTCTTGTGGGAGCGACTTCACTCGAAAGACTCG
CTCTCGCCCGGCCGATGGACACATGTCGCAGTGGTCGTAGAAGGCTCCAAACTGCGGCTCTACATGAACGGCATTCTTGACTGCCAGCGATCGCTTTCTG
GTCCACTCGCCACGGCGCTGAACAGTGGAAGCGTGGATCTCGACTTCGGCTTTGGCCGACAGCAGCCGATCGCTCCTTCGCAATCGCTAGACGATGCCGA
AGCTGAGTCTGCCGAAGTCGATCAGTCATTTCTCCGAGCGGCCAAGGCGATGGCATTCCTGTCGACTCTCGTATCGGTGAACGCCGCGACGTCAACTTCG
GTGATTGCGACGCCCTCCCCCAAGCCTCTCGTGCGTAGTTTCCATGGGTTGTTGAGCCACTTTCGCTTCCACAACCGGTCGCTCTCGCCCATTCATGTGC
GCATTGTGTACGACGAGAAGAAACCGGTCAAAGAAGACGGGTCCTCTGCAAGCGCGCTCGCTTCTCGGTTCCTCCCTGACGATACGACCACCAAGATGGT
CCAACTACACGCATTGCTGCGCGTGATGGTCGAGTCTGACGAAGGCCGTGTCCACCTCGCGGATCCGATGTGGTCCGCCCAGCTGTGGGAGATCTTTCTG
AGCAGCCAGCACGCCTCTTCGCAACTGTCAAGCGTGCGTCTGCTTCGTCGGGTGTTGCTCTTTCAGAGCCCCCGTGCCGTCGCTGACGCGATCTGTGTAT
CAAAGCCGCAACCAGGCTACCGTTTTGTGGTCCACATACTGCGAATCATCGGAGCGTGTCTGTTGCCTGTATGGGTCCGCTGTGACTCAATGCCGGCCAC
GCTTCAAAAGCCAATAGAAATCGGCGAGCACGAGACCGCCGTGGAGCTGCGCAATTCGACCGCCGAGCGATTACTACTGGAAAGTGCACGCGGATCCATC
TCGATACCGCTTGCCAACGAGCTCACAGGCTTGCTGATAGAGTTACTGCAGAACGAGAGCAATGCATCGTGGCCGATGGAGATTTGGAAGGCATTCGGTG
ACGTGCTATGGGAAGATAGCGAGGCGATCTCTTCGGATGTTGACCAAGCGCGAATCGGGTGTCTTTATGTGCTGGGCGGATCCGCCACCATGCTTACGAG
CGGCACGCCAGTCGACCTGAAGGGTACGAGCGAGCAGGCGACCGTCATTGCGGTGGGTGATCCCGTACCGTCGATGGTCGTAACGTCGCATACGGTGGAG
GGCGTGTCCACGAACCGACAAGCACCCACAGTCTATGCATGTATCCATGGGGAAGATACAACCGAGTCGCCACGAGACACGATCAAGGACGGGGCGTGGT
CGGATCAAGTGCACGCCGAGTGCGTGAAATATAGAAAGCATCAGATGGCTTCCAGTAGTCAGCCGCCCGCACAGAAGAAGAATCACGACCGCATGGGTGA
AGACGACTCGGGAACGGTGCCGTTTGTGCGGCTCCACCGTGACGACGTCGCTGCCACCTCCCCGATCAACGTGGTTGCTCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGGTGTGGCCGAGTTGAAGCGCTGGCTGAGCTCGGGTCTCATTATCCAAGCAGTACTACGTGT
GGCATCAGACCACGCCAGCGCCTCTCATCTTCTGCGTGATGGCCGTTTGCTTCTGA