Transcript Name :
Pytar_ATCC12531maker-par_contig_1-snap-gene-0.34
Orientation:
(-)
Number of Exons:
1
Description :
HECT E3 ubiquitin ligase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote10.836PS50030
B30.2/SPRY domain21.544PS50188
HECT41.889PS50237
HmmSmart predictionP-Valprediction_id
Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote1.7SM00165
SPla/RYanodine receptor subgroup3.9SM00449
HECT2.7SM00119
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryoteIPR015940
B30.2/SPRY domainIPR001870
SPla/RYanodine receptor subgroupIPR018355
*** None ***
InsideOutsideTMhelix
1-1698
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ubiquitin-protein transferase activityGO:0004842IEA
*** None ***
*** None ***
Sequence
        5097 bases(100 bases per row)
ATGCTCGAGATCAGCAGCAGCGAGGATGGGAATCCACATTTTTCGACGTTCGAACACATTGAACGCAAGCTCTGGATCGTACGAACACAAGTGTACCAAG
TGCTCCATGATCTCCAGGAGCAAGGCGAGGTGGAAGTGGACCAATGGCTCAAGGCCAGACAGGCCAAAGCCAAGGCGAAAGCCATGACCTTCCAAAAGTC
ACAGAGTGATTCTAAGTCGCCGACGCTGAGAGAAGACGATGACGATGTAGCCTTCGAACGCACGGAGTCGATAGCACTACCAACCACCAAACTAGACCTA
CGCCTGGATCTCGCCATAGAGGATCCGGCAAACGACCAACACACTGCAGAAAGCCAGAGGAGTCGCGGCAGCTCCAGCGCCAGCCCAGATGATAACGCTC
TCGACACGCCAAAGAGACACCCTCAGGACTGCCCTGTTGATGTCGACGACCAAGACGATGACAAGGATGGCGAAGAGGAGGAGGGGGAAGAGGACGACGA
AGACGACGACGACGACGGCGAGGATGACGACGACGAAGACGAGGACGACGAAAATGCGGCGGAGCATCGCCAGGCATTTGTCGACGAGCTGATGATGATG
GGGTTCCCGGAGGAATGGTGTGTGCTGGCATTGAAACAGACAGAGAACGACATTGTCAGCGCCTCAGCCTGGATTGTTGACAACCTCGACTACCTCAGCC
GGCTTCAAACATCGCTTGACAAGCAGCGCGACCAAAGCGCCGAGAGCAAGCTCGTGTTTGAGGACGAAGACGACGATGAGGACAAGGACGAAGGAGGCCA
AGCGTGCACCGACGGTGAGGAACCTCATCCGACGACTGGGGTTAATGATCCTCCCAGATCGGGGCAACGAAGCAGCGGTGGCCTTCGAAGCCACCCACAG
AGTCCGATGNNNNNNNNNNNNNNATCGGATGGACCACAACCGCAGCAGCTCATCAACGAGAAAGAAATGGGCCGCAAGATTTTTGGTGAGATGTATTTCC
CCTTTGAAGCTGGCGGCTTCGATTCGAACGCCAAAGATCGGTTCTTCACTCCGTGGCGATCCGAGAATGCCTCGGGAACAACCCTACCAGCAGCAGCAGC
TACAGCTACAACAGCGACAGAGAATTCAGAGGACTCAAGTCCACCTCAACAATTCAGCGACCAGCCCTTGCGAGCGGATGCTGATACGATTGGGCAGTTT
GCTGCGACCGTCGAGGCGCTCGAGCTCTGTGAGCTGCTGGATCGCCTGGCCGAGTTAGAACGAGCGTTTCTCGTCCTCTCGTGTCGGCAAGTGGTAGTTT
CGCTGCTCCAGCACAATGACGGCGGCAGTGAAGTGGCAGTTGCGGCAATCCTCGATTTACCGTCATTCTTCACGTTCCTCAAGCTCGTGCTGTATCGAGG
GCCTCAGTTTCAAGTACGGCAGACACACGTTTTTGCCTGTGGAGACGATGAGATTGTGGATGTCGAGACTGTTATGCGCGGGTGCATTGCCCGTATGCTG
CGCGAACAGCGCGGCATGTTTGCCCAGCGTGTTATCGACTATGCACTCGTGCAAATTGAAGCGGCAGCGATCAGCAGCTCGCCATTTGAAGCCATCTTAT
GGACGCAGCGTGAACTGCGGCGTGCGGACCAAGTCGTCCTGGAGGAGCCAGCAGTTGAGCTGGCCGCATGGCTGTTAGATCTCGTGCTCGGGGTCGGTCC
CGTCACGACGATGGCGATCGACCTTTCCTCCGAGCAGGCGGCGACGCTGCTGCAGCGACTGCGACCCACGCTACGATCCAGTAATCTCCCAGTCAAGTTC
ATTGTCATCACGACCATGAGCCGTGTACTGCAACGCATTCGTCTCCTCCAACGACAGCCAGCATCCGCATCGAACCGGTCGCTAGTTTCGGTGCTCGATA
CGTGTCGGCAAGACGTTGCGAGCTTTCTGTGTGCCGCTCGAAATCGTTTCGTGCGTGAGCAGAGACAGCACCGCGCAATCTTCTCGTCGTATCTCCTCGC
GTACGTCGAGATCATCTATCTTCTCCAACAAGTCGCCGTCATCGAGTCGGAAGGCTTCGAGCCAAATGCGGCAGAACTCCCCCCACCGATTCCGACGTCA
TGTTTCGGTCCTGCGAGTTCGCAGGCGACAGCCGTGCATTACCCAACGCTGGCCTTCGACCGAGTCAAGAGTCGCAGTAGTCTCCTGCAAATCTCTGACG
ACGGACTCACGGCTGCCTACTCAGGGAACGATCTGTGGAAGACTGTGCTGGTCACGCAGAGCTTTGCGACAGGCGTCCATGAGTGGCACCTACGCATCGA
AAAGTCGTCGTCTTCCTATCTCTTTCTCGGTGTCGCGACCCGCAAAGCCAATTTGGAGTCGTTTCTCGGGGCGGACGACCAGTCGTGGGGCTTCATAGGC
GACAAGGCGGTGTACTATCAACGCAATCGACTCCGCGTGTACGGCGACGCGTTTGGTGAGGGCGACGTGGTCGGCGTCCATCTCGACTGCGAACGTGGCA
CGCTGGGCTTCAGCAAGAACGGCGTCTTTTGTGGTGTCGCGTTTGAGAATCTCATGGACGAAGTGTTTCCGGCCGTGGCGTTTTACTCGCGCCACCAAAA
GGTATCGATCGTATGGCCGGATGATGACTCGCGTCAAGATCCCACGTCATGTCACAGCTCGATAGTGAGTGACGGCACTGTCGAAGAAGCAGTCGCTGTG
TGTGAGATGATGGACACCATGGTGGCCTCGTCCCCACACCCACCACGGCTGCTGTGGCCGGCCTACGAGATGACCATGGCGTGGTGCCACGGTACAGGGC
GCGACATTATGACGCGCGCTGGCTCACCGCTGTGGGTTGACACCACGAGCGCGACGTGCGCGCGCTTTGGCTTCCAGGCTGATGAGCAAGTGCGATGCCC
TCGCGGGAACGGCCGCGTTCTCGGCGTCGCCGACGATCGGCTGTGGGTCGTAGTCGACGGTGAGCCCGGAGCGTGGCATATCCACCCGTCCAAACTGCGC
ACCATGAAGTTGTCAGTGGGGGATACTCCATCCGAACCTGATCTGACCCTCTTAACAGCACCACCGGAGCCACGAACGAGACGTGCGCCAGTCGCAGTAG
TAACTCTGCCCGAGATGGACACTGGTGATTCGCTCACGCAGGCGGAATTCACGGCGTTTGTACACGATCGCATCTGGTCGGTGCGGCTCGATGGGGTCGT
GCTGACTGTCATCAACGCCCACTGCGAATCCGCCAGTCTCAGTCCCTGGAACCTCCCACCACGCGAACTCGTGCGCATCGTCCGCGCAAAAGCCCATGAG
ATCGAGCAGGCCACGGGCGTCTCCACGTTTGGGGGCAGCGACGGCGGGCGGCGTTTCGAGCGCAAACTGCTCGCGCGGTTTGGCTTTTTGCGCTTCTTCA
ACGCGTACATGCGTCGCGTGCTTCGCTTTTTCGACCGCACGTGGTCGTATTTCCAAGGGTCTTCCTTCATTGGCGGACTCTTGCCGAGTCGGCTTCTCTC
ACAATGTCGCAGCAGCATCTTCACGTGCATCAAGAACGAGTTTTTCACGGCGCTCTTGGCCAAGACAGCCAATTCGCCCTCGAACAAATCGGACGACGAC
TACGACTACCCCGATGACCTGCTCCAACTCCAACTCAATCGCCCGCAAGCCGCGTCGGCCAAGTGCCACCCGGGCACGACCGCGAGCCTCATGGCGTCGC
TCTTTGGGCAGGCGTTTGACGCGCTCCACTTTCAGCCGCTGCGCTTGCTGCGCATGGTCTATTCACATCCCATGGACGACGGCCAATGGCGCAGCTTCAA
GGTCAAGTTCGAAGGCGAGGGCGTCGACGACTATGGCGGCCCCTACCGTGAGTTCTTTTCGCAGTTCTTCGCCGAGCTGCAACTGGTTGACACGGCGGAA
GGAGACGACAGGAGACCGGACACGAGCCTTCTGCCGTTCCTGCTGCCGAGTCCCAACTGGCGCCACGGCGTCGGTGCAAGCCGCGAGCGGTTCGTGTTGA
ACGGTGGCCTAGTCGGGTCCTGCCACGTTGGCTCGGTGCGTGTCGTCTCGACAAGGACGCAAGACCCAACGCGCAAGCGCGGCTGGGCCGAGCACGCGCA
CGTCAAGCGCCAGTTGCACAGAGAGATGGTCCACTTTCTGGGCCAAATGATCGGCGTCGCCTTGCGCACGCGCGTCTGCGTGCGCTTGGACCTGGCTCCA
TCCGTGTGGAAACAGCTCGTCGGCCACGAGCATGAAGGCAAGGAGGACCTGCTGGCAGATCTCCACGAGACTGACCATGCGGCCCACGCGCTGCTCCAGA
CGCTGGTCTCTCTCCACGAGACGTTCACGAAACCAACGACTGACGAGCGTCGGCGGCAGGCAATCGCCGATCAGGTCGCGGCCATGGATCTATCGTTCAC
GACGTGCCTCTCGGACGGCCGCGTAGTCGAACTCTGTCCCAACGGCGGTGAGACGGTCGTGACCACGGCTAATATGGGGCAATACATTCACCTCGTGGTG
CACGCACGCCGAGACGAGACGAGAAACTTCGTGAATGTGCTCAAGCAAGGGATCCACTCGGTCATCCCGGTCGCGGCGCTGAGCGTTCTTACGGGGGAAG
AGCTCGAGACGCGACTCTGTGGCGCCGCCAAAGTCGATATTGCGCTGCTCCAGCAAAACACCGAGTACGACGACGACGTGGCGCCGCACCACGAGAGCGT
CCAACGCTTCTGGCGCGTGCTGGCGGCCATGGACGACGACGACCAGCGCGCCTTCTTGCGGTTCGTGTGGGCGCGCGCACGACTGCCCGTGGGTCAGGCC
CAGTTCCACCAAAAGTTCAAGATCCAGTCCTTGGCGCCCACTGCTGACAGTGACATCACTGCCAACAGTAGTGCTACTGCTGCCTCCACGACGGCGTACG
CTGACGGCCAACTGCCCAAGGCCCACACGTGCTTTTTCGCGCTGCAGCTGCCGCGGTACTCGACGGACGAGATCTGCCGCCGCCAACTGCTCTATGCGAT
CCGCAACTGCGTCGAAATGGACGGCGACTTCCGCCTCGCCGACGCCGAGATGACTGGCTGGACCAACGTGGACCCGAACGACCAGCTGCGGTTCTGA