Transcript Name :
Pytar_ATCC12531maker-par_contig_1-snap-gene-0.25
Orientation:
(+)
Number of Exons:
1
Description :
Protein kinase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7220.78724
InsideOutsideTMhelix
1-130
NN-scoreoddsWeighted Score
0.8275.1060.01
*** None ***
TypeScore
extracellular, including cell wall222
GO
*** None ***
*** None ***
*** None ***
Sequence
        393 bases(100 bases per row)
ATGACGACGTTCCTGCGGCGCGTGCTCGCGCTCGCGGCGGTCTCCTTCTCGCTCGCGGCGGCCGACGGCGACCTCGTGCGGCGACTCTACCAGGCCGAGC
AAAACGGCGTCCCGGCGTCGCCCGTGGCGATCCCGGCCAAGGACCTCCCGGTCACCATCAAGGACCGGCTCGCGAAGTTCAACAATGTGCAGTGGGAGAC
GCTCTCGCCGCTGCTCCAGCGCGCCGTGATCTGGGACTCGGGCTTTGTGTTCGCGACGCCCACGCGCCTCGTGCAGATCTACACGAGCTGCTCGCGCACG
ATGGCCGACATGCACGTCGACATCGCCGTCATCAAGACGCTCGAGGCGAACCGCACCGACTGTGNNNNNNNNNNNNNNTGCGCTGCGGCATGA