Transcript Name :
Pytar_ATCC12531maker-par_contig_1-snap-gene-0.30
Orientation:
(+)
Number of Exons:
3
Description :
Ubiquitin carboxyl-terminal hydrolase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ubiquitin carboxyl-terminal hydrolases family 221.436PS50235
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-383
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
obsolete ubiquitin thiolesterase activityGO:0004221IEA
ubiquitin-dependent protein catabolic processGO:0006511IEA
*** None ***
*** None ***
Sequence
        1326 bases(100 bases per row)
ATGGGCAACACGTGCTTCATGAACGCCGTACTCCAGGCGCTCGCCCACAACCCGCTCGTGCAGCACGAGTACTTCGTGCTGCGTGGTCACGACACGACCA
TCTGCGAACAGAAGCGACGACAAGACGCAAGCAAGGGCATAGCGGATCCGCCCGCGGCCATGGCACCGTGCATGGGCTGTGAGATGGCGTCGCTGCTGCA
AACGCTCTTCCCGGCACCGCGCGCCACGCTCACGGCTCGCCACCTGACGTCGCCCGTCGTGCCGCAGTCGTTCTTGGAGACGTTCTGGGCGTCTGCGCCC
AGTTTCATCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAGCAGGACGCGCACGAGTTTCTCGTCACGCTACTCAATGCCGTCCACAAGG
ACACGTGCCCGCGGACAGTCTCGCCTCCAGTGACTGACTCGACGCAGCAAAAGACTCCGCCACCACCACCGTCCTCGCCGCGATTCTCTGCCACGGGCCA
GTCCCTGTGCGACTGCGTGGCGCACCACAATTTCGCCGGCGTCTTCAGCTCGGAGATTGCGTGCGTGTTCTGCGACACGGTGAGCAGCAAGTACGATCCG
TTTCTCGACGTCACGCTGTCGGTAGAGTCTCCGACCTCGACGTCCCGCAAGTCGAACAGTACGAAATCCAAAGACGACGAGCCGACTGCGCCAGCGCCGC
TGTCGCTGGTCTCACTGCTGGAGCGATTTACGTACGAAGAGCGACTGAAGGGATCCGACCAAGTGTACTGCCTTCGCTGTTCTCGCTACGTCGACGCGAT
GAAGCGACTCGTGATCCATAAGCTGCCGAATCTCTTGGTGCTCCATTTGGGGCGGTTCGACTTTGCAAAGAAGCGGAAAATCACCGACGCCGTGACGTTC
CCACTCCGAGGTCTGGATCTCAGCGAGTTTTGCAGCGACGCGGACGACGGAGTTGCGACAAGCAGCCAGAGCCACAACGGGCGAGACGTCGCCATCACGG
CAGCCGACATATCGTCGGGCAGAATCAGCCCCTTGACACCACTGTCGGCACCTCAAATGCGTGATGCCATTTACGACCTCGCAGCTGTGGTCAGCCACCA
CGGCGACTCGGTGGACGGCGGTCACTTCACGGCGTTTGTGCACAGCGCGGCAGAAGAAGGCACTGACCCCGTCGAGGACGGCGTGGCGGCAGCGGTGGCC
ACNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGACGACTCCAAGGTGGAGCGTGTGTCTTCGGAACAAGTGGAAGCGAGCCAGGCGTACTTGCTGTTCT
ACGTGCGGCGCCGTCTTTTCGTGTGA