Transcript Name :
Albla_Nc14000170
Orientation:
(-)
Number of Exons:
3
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat-containing domain10.002PS50293
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat48SM00028
Tetratricopeptide repeat4.3SM00028
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
3602
Sequence
        1951 bases(100 bases per row)
ATGAAGCTTTCCGAACAAGGATCAAACGAACTTTGTGCACGCTTGAATGGAGTCGAAGTGCCAACATCGTCGACAGTCTTTCTTTCCAATGAGTGTCAAT
CACCTGTGCCTAATGCCAAATGCAGCGTATCCGAAGAGAACAACATATTTGACGAAGTCACAAAACGATTTCAGCTGGAAGATTTCACTCGCTTTTCTCA
ATCTCATCTTTGGAAACTCATGACGGCCTTCTACGAATCTCAAGGTGTTGCATCCTGGGCAGAAGGAATTGTCCCACACTTCATCACTTCGAATTCCTTT
ATTGCAAAACGATATGCCCAGCTTCTCATTGCCTACTTTTCTGATGGAAGTAAACAAATCGTAATATTTTCTTTTAATTTACTCGAAATGAAACTGCACG
TGACCGTAACGTTTTGATCTTCGTGTTTCATGTAGCTCAATAAAGAAGAACCGCTATACATTGTGGAACTCGGGGCAGGATCTGGAAAATTCAGCTTCTA
TCTTTTGCAAACGTTATCAGAGATGGAGGTGGCGCTAGTCTAAAACACTTATTCCACAAAGCACTTACTTCAAAATTGTGTAGGACTGTCTAGACTTTCC
TCTGAGCAAAATCCGGTACGTCATGACGGATTTTACTGAGAAGAACGTAAATTACTGGAGAGAGCATGTTGCTCTTCAGCCTTTTGTGAAGCGAGGCTTG
GTAGATTTTGCAATCTTCGATGCCACAAAAGACACTGAGCTTCAATTACGTATCTCTTGCACAACAGTGAAACCGGGTGAATTAATCAATCCAATTTGTA
TCATAGCAAATTATCTTTTCGATACCCTTCACCATGACCTATTTCAAATCGATCAAAGTTGTATTAAGGAAGGTCTGATTAGCGTTGGATCAAGCAGAGA
CATTGAACTCAATCCTTTAGATCCTGAAATAATTACTCGTCTCGATAATCAGTTCAAATATGAGATAGCCCGTCCAGAAGCGGGCAAGCGAGACATATCC
AGCGCTATTATGGAATGGTACCTCCGATATTTTACTCAGAAATCATGCCCCGCAACGATATTAATCCCTATTGGTGCGCTAGATGTATTAGAGCGTTTGA
ATGCTCTATCGTCCGGAAAAGCACTGATACTTTCGGCTGATAAAGGCTCCACTTGTCCGGATCATTTCCGTGGTTTGAATGATCCTCATATCGCTGTCCA
TGGGAGTTTTTCTGTCATGGTGAATTATCACGCGATTGGGATATATGCGGCACTTCTTGGCGGTTTCGCAATTCACTCCCCTCAAGAGGAAGCAAGTCTC
ACAGTATCAATCTTTGTCCTTCCGCAGCGGTCCTCAGACTTTAATTTTTGTACAACGATTCTTCTAAGCGAAGAACTTGATCACTTGAACGCGCACAGGA
AGGCTGCATTCCCTAAACTAAAAGCGGCTTTCAATGAATGGATCACTGCGTTCGGTCCAAATGATTTCTTCGTAATCCAAAAAGCGTTGAAAGAAGAAGT
CAACCTTCGCTCCGTAAAAAGTGTTCTAGCTTTGCTGAAATTATCAAACTGGGACCCTGACGTATTCTACAAATATCGAGATGTGCTGCTAGAATCATCA
CCAGCTAGCTCTTCCAAAATGAAAAGCGACGTTCGAGCTGGCATTTCACACTTATGGAAGAAGTATTATGCTTTGGACAAAGAAAAAGACATTGCCTTTG
AATTAGGAAGATTATGTTATGGTATGCAAGACTATGATCTTGCGTTAAACTTTTATCGTGCATCTATACAAGAACTGGGTAAGCATCATGTAACGAGCCA
CAATATGGGCTTATGCTATTACAACAAACACCAGCTTGATTTAGCGGCAGAGCGATTTGGAGAAGCGCATGAACTTAATGCCTCTTACCAGAAAGCTATT
ACCTGGCTCGAGCGCGTCCGAAAAGAGCAGACTGCTGTGCGCGACAAATAA