/usr/amritdata/protein/develop/executables/log_for_browse/loglikelihood -s /tmp/images/bd_sequence_input_file_c758f84af6c4910cdc7ccbbe421e13a7 -m /usr/amritdata/protein/develop/executables/log_for_browse/matrix/890382 -w 120 -web -o /tmp/images/bd_log_output_file_c758f84af6c4910cdc7ccbbe421e13a7
Transcript Name :
Albla_Nc14000160
Orientation:
(+)
Number of Exons:
3
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
G-protein beta WD-40 repeat3.6PR00320
G-protein beta WD-40 repeat3.6PR00320
G-protein beta WD-40 repeat3.6PR00320
Profile scan predictionP-Valprediction_id
WD40-repeat-containing domain9.336PS50294
WD40 repeat9.472PS50082
WD40-repeat-containing domain23.229PS50294
WD40 repeat10.007PS50082
WD40 repeat11.11PS50082
WD40 repeat9.138PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat0.0039SM00320
WD40 repeat0.16SM00320
WD40 repeat1.7SM00320
WD40 repeat7.3SM00320
WD40 repeat5SM00320
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
G-protein beta WD-40 repeatIPR020472
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
3601
Sequence
        1374 bases(100 bases per row)
ATGAGCTACCATCGCAATAATCGCGCCGGCGGAGGACGCGGCCGTAATCGAGAGAATTTCGGTAATCGTGATGGTGGAAGAGGCTCTACATCTAGCGGCT
GTAAGAAAGGTAGCGAAATATGTCGCCGTTTTATACTCGGAGGCTGCGACTTTGAGCAAATCAATGGACGACCATGTCGCTATCCTCACTTGCTGAAGAA
GATTGGTGAAACACGTGGACATAGTGGACCTGTTAAGGACATTGTCCTATGGAATGCACGTCAACAAGTTTTCACGTGTGGTGCCGACTCGTGTCTCAAA
CTGTGGGATTGCGCATCTTGGAATGAGATTAGCACACTCAGCGTGTTAGCACCATCGAATGGGATAGCCATAGGCAAAAAGTCTTCGCAAAAGTCGGAAG
GTGTTGTCTCAATGGTACTGGAAGGTCCCTTTCTATTTGCTGGTTTCGAGAGCACATATCAATACAACTCATCCTTATCGGTGGGAATGATTCGAGCTTG
GAACCTCGAAATGCCACAAATGCCACCTTTTGAATTCTACACCAATGAAAGTTCAAAGCATGCACATACAATGAATGTTTTATCTCTTGCAGTTGCGACG
GATTCGTCCGGAGGTGCTACATTATTCAGCGGTAGTGCAGACGGATCAATCAAATACTGGAAGTTAGATCCCGTGGCAAATGTATTTCGGTGCAGTGGCA
CACTCGAAGGTCACACAAGAGGTGTGACACGTCTCAAGACTACGCTTATTAGCACCATGCCAGTGTAGGCGCTGCTTGTATACGAAAGTAATGTGAGTCC
TGACTTTTTTGTATCAATGATTAGACTAGCGTCCGCATCAGTCGATTCTACTATTCGGCTTTGGGATCTGGCGACGTATCAATGCATCAAAGTACTTTCT
TTAGAGGAAGGCGGACATACAGATGCTGTCATGGATCTTGAGATGTGGGCAAATCAAAGCGAGAGCTTTTTGATAAGCGGAGGACTTGATTCAGAAGTAA
TAGTTTGGAACTTGAGCCCTCCATTCCAGCAGGTTTTCAAAGAAACTCAGTCTTGCCAAGTGACAGCAATATGTGGCGCACAAGATGCTATTAGTCAGCC
CATCTTATTAATTGGGAGCACTGTGAGTCATCTATTTCTCTCTTGTATGCTTGCATATTTTAATGTTTGATATTAGGACGGTTCTATTACGATCAAAGAG
CTACCAACATTTGCTTACAAGACAACGCTCTCTACAAGCGCCAACTATGGACATCAAGATGCAGTGCGTCGTATAATTTCAGGTCCGCATAACACGCTAT
TCTCGGTAGGTAATGACCGTAAAATGATTGCATGGCAAATCACCGGAGATATTCGATCCATTGAGTCCAAATAA