Transcript Name :
Phyra_83517
Orientation:
(+)
Number of Exons:
1
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, FYVE-related10.229PS50178
WW domain8.512PS50020
HmmSmart predictionP-Valprediction_id
FYVE zinc finger0.0016SM00064
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, FYVE-relatedIPR017455
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
metal ion bindingGO:0046872IEA
*** None ***
Cluster Id
3695
Sequence
        3291 bases(100 bases per row)
ATGCCGCGCCCCGAGTACGCGCCGTTCATCACGTCGCCGCGCGGCGCATCCGTCCCCGTGGCAGGATCGGCCCCCTCCGCCGTCTCGGCTCTCGCCGCCG
CCTCCGAGACCCTCAGCGCCGCGCTCAGCGTCGCCAAGCTCAACCTGCACCGGCGCCGCCGTCAGACGCTCACCGACTCGCGCAACACCAGCAACGGACG
CACGCCCTACTTGGACCGAGACGACGACGACGAGGACGACCCGTTCGATCCGCCGCAGGCCCCACAGCAGCGACAGCGCAGCCAGCCGCGGCCCAGGAAA
CCCGTGCGCTCGCCCTCGTCGTCCACGTCGTCGGCGCCCTCGCCTTCCTCTCGGCGCTCGGGAGGCTTCGCGTCTCTTCTCTCGTCCTCGTCGCTGTCGG
CGCGCTCGCCGTCCGCGCGGTCGTCGTCGGCCACGTCGCCCTCGAGTCTGCGGGACGAGAGCGCGTCGTCTATGGTGAGCGACATGGCGCTGCACCTGCC
CGAGCTTTCGCCTGAGCGCGTCGAGGCGCTCGTCAACTTCATCGACAGGTCCGTGGACGACGCGTACAACCTCAGCCTCGGCTTCGGCCGCGTGCGCTGG
ACGCCCAGTCGCGCGCGAGAAGCCGTGACGATCCACCGCGCGAGGAGCGGCCCGGACGACGCGCTGCTGGACGCCGCCGTGCGCGGAAGCTGCAACATCA
GCGCCACGTTCAGAGAAATGAGCGACCTGCTCATCACCGAGACGAGCGCAGACTTTGCCGACCACGAGAACGCAGTGAACCCGACCGAGTTCCTAGACGG
ACAGGTGCTCTACACGCTCGTGCCGCGCACCCCCGGGGAGCGCTTCGTGTGTGTCAAGTGGCACTGCGCACGGTCCCTGGCGCCGTCCGTCGCGAGACAC
CGGGACTACGTCTACGTGGAGCTCGTGGACTCGTTCGAAGACGGCGACGGCCGCCGCATCGGCTACCGACTCAGCAAGAGTGTGGACCTGGACGTCCCCA
CACCGCGCGACCCGAAGCATCACTTCGTGAGGGCCAAGACGTTGACGCTGCAGACGTGGAGCGAGCGAGCGCCAGGGAGTCTGGAATTTGTTACCATGAT
GATCAACGATCTGGGAGACCGCCTGCCGTCGTGGCTTGTGCACAAGATGGTGGACACGGCTGCCATGCGCTCCGCGTGCATTCGAGACCACATCAACCAG
CGCCGCCTCGATCTGATGGTGTACGCTGGGCCGAGAGACATGGTGCCGCTCAGCCGGCGCGTTTGCTGTGTGGTGTGCACGCGCAGCTTCTCGCTCGTGC
GCAAGAAATACAACTGTGACGGCTGCGGAGATGTCATCTGCAGTCAGTGCAGTGTGCACCAGCTCGTGACCGCCCACCAGCGACTGAGTGATCTATCGGC
GCCCGGAGGCAAGCGCAAGGCGCGGATTTGTGCCAAGTGCAGCATCAGGATGAAGGAAAGAGAGCTTCCGCGGCGTGCATCGTCTGCACGACAGAGCGAC
ATTTCACGTGTCAGCTCCGAAGGTAGTATTCGCAGCTCCCTGGCGTCTAATAACTCGTTTCTAGGGCGCTCGCACGTGTCAGCAGGAAAGACTTCGGACG
AGACGCGACGTAGTTTCCTCTCGGACTCGACAGCAGGCACAAGCTCGCTAGACTCCGTCGACGATGGCAGCAGAGGTAGTGGCAACGGATCCACGACCGC
GGGGGCGCGCAAACAGGTTCCCAACATGTTTCAGTTCCGCCCGACATCCTCGTCCATGGGGAAGAGTGAGCGATTATCAAAGGCGTCTACATCACCGTCG
TCTCCCGGGGACGAAGAGGACCGACTTGATGTCGAAGAACTACAGCCGCAACTGCTAGGTGACAGCATTCTAGCCCCTGCACCCGTGGAGCTGGATCTAG
GCGTCGGCAAGTACAAACAAACCTTCACGCAGGAGCCAACACGGACCGATAAGGATTACGAGGCCGAAGCAGCCGAACTAGCAGAATACAGCGACTCGGA
TGAGGAGGGATTTTCCGAGGACGACGCAGGCAACTTCCTTAATACCGAAGGCAGCAGCCACGTGCGGGAATCGTTGTCACAGGCAACAGTTATGACGCTG
GACATGGATATGCCGACAGTGCACAAGGTGGAAGTCGCCAGCTTTCTCACGGAAGAAGAAAATGCGAACTTGGACACGGTGTCGAATGACTCGGACTCTG
CTAGTTTTCTTACTGTGGACGAGAACTCGAAGATTGTGGAGAGCAGGTCGTTTGGTGGAAGGTCGGAAGCTCCAGTTCCCGTGCAGGTAGAAGAGCTGAT
TGTAGAAGAGATCTTGCCCGAGACGATGCGTACCGTCCCGCGGCGCAGTATGGAGCTGGAGGAAGCGGAGGTGGAAGAGCTGGTCATAGAGGAGATCCAG
CCTGTAAATGTAGGCATTGTTCCGCGTCGCAGTATGGAGTCGGAGGAGCTGGAACTGGAAGAGATCCAGCCGAGCTCTGTTCCGCGCCGCAATATCGAGG
CAGAAGTAGAAGAGGTGGAGGTGCCCATGGTGGTTCGCAAAGTGGCAAAGCGGTTAGTTGTTGGTTCTGGTGGGCGACGCAGTCACAACTCACGACGGTC
GCCAGCGCCAAGGCCTAGCGGTGCTCCGCCCCCGCCACCGAATGTAGCAGCCATGCTTACCGACAGTATCGCCAGTGCTGGCGCCAGTAAGAAGGCCCAG
GTGGCATCGAATGGCTCACGCGCTGCGCCGCCTCCAACACCTGCAGCTGCTCCAGCGCCTATGTCTACGCCTGCGCCGGAAGAAGATACACTCAAGGTCG
AGGATCTGCAGGTGCATCTGGATCGCATGAACCAGATCTCGGCGAATCTGCGCGATATGCGCAAGGAGATGAAGGAGACGACTGAGGCTCCTGCCAGTAC
GCAGTCGGCGATGGCGGCACTCACCACGTTCGAGACCAAGGCCAATGCCGAGCGTGCCGCCAAGATTGCGGCCAACTTCATCAGTTTGCTGGACCGAAAT
GCGGCCCCTGCAGCTCGTCGCGCGCAGCAGCAGCTCAAGCAGCTTGGTGGGCCTCGCACGAGTTTGTTCAATTTGACACTGGCCATGGGCGATGGAAGCT
TCGTGGATTACCTCATGGACTCGACGTTTGAGGATGTTGGAGAGAGCCCCGATGGCACCGGCTTGGGGTGGCAGTCGGTGCAGTCACAGACGACAGGCAA
GCAGTATTTCTTCAACCAGAACTGCGCGCTCGCGTCCTGGACTCTTCCGGGGCCCGACGTCTTCCGGGGAACGCTTTACATTGTGCTCTAA