Transcript Name :
Phyra_83322
Orientation:
(-)
Number of Exons:
1
Description :
leucine-rich repeat protein, putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Leucine-rich repeat, cysteine-containing subtype35SM00367
Leucine-rich repeat, cysteine-containing subtype410SM00367
Leucine-rich repeat, cysteine-containing subtype170SM00367
Leucine-rich repeat, cysteine-containing subtype83SM00367
Leucine-rich repeat, cysteine-containing subtype360SM00367
Leucine-rich repeat, cysteine-containing subtype88SM00367
Leucine-rich repeat, cysteine-containing subtype450SM00367
Leucine-rich repeat, cysteine-containing subtype200SM00367
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Leucine-rich repeat, cysteine-containing subtypeIPR006553
*** None ***
*** None ***
NN-scoreoddsWeighted Score
0.5721.3270.003
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1941 bases(100 bases per row)
ATGCCCGTGGAGCTCTGGGATGGGCACTTGATCCCATTCCTCTCGTTGGACGAAGCGGTGGCGTTGGCAGAGCTCAATCGATTCTTCTACGACATCGTGC
ACAAACAGATTCAGATTCAAGCCGAGGCCTCGCTGGTGTGCACCATTCCAGAGCTGCTCCGAGTGTTGAGGAAATGGCACAACCTGCGCAACGTGGCTTT
TCAACCTGTCGGCGATGGACCGGAGATACACGAAAGCATTCACTACAACGTGAACGCTGCTGGTGGCCTCATCGTCGACCACCAGGACAACCAACCCGCC
CCAGAGCCTGAACCAGCTCAAGTGTCGAACGAGAGCTACACCGACGAAGACGGCGTGAGCATTCCGATGCGGTATAGCTGCCCCAAAGTGCTTCGAGATT
GCATCCAAGTCGGCGACAACAGCCAAGTGAGGCGGTTGAACTTGTCAGGAATCGTGCGCGTGAATTTATTCGATGGGGTGAATCGCTTGCGGGAGCTTGG
ACTGAGCGGCTGCAGCCAGATCGACGGACTGCACTGGTTGTCCGGCATTCGCGAGGTGGACCTGAGCTACTGCAGTTTTCTTGAGGACGTTTCGTTCCTG
AGTCATTCTCAGCACGTGGACTTGTCCTATTGCCACACTGTTACAGACCTCACACCGCTGGCAAAGTGCGAGTCGGTGCATCTCAACGTGTGTCGCGGTG
TCAGCGATGTGAGCCCGCTGAGTCATGTGCACCGTCTAAGTCTGCGTAATTGTCCCGACGTAAGTGACGTGAGTGCACTCGGCAACGTGTACGAGCTGAA
TCTGGGTGGCTGCGCGAATGTGAGGAACGTCAGCACATTGGGCAATGTCCACGAGTTGAACCTCTCCGGCTGCATCAACGTGACCGACGTCAGCGGCCTC
GGCACAGTTCACACTCTCAAACTGCGCAAGTGCTCGGGCATCGTCGACGTCTCGGCACTCGGCGGTGTACAGGACTTGGACCTCACAGGGTGCATCAACG
TCACGGATGTGAGCGCACTAGGACGCGTGTCCAAGCTCCAGCTTGCGCTCTGCAGACACGTGAGCGACATTTCCGCGCTGGGCAGTGGTGTACAGGAGCT
TTCGCTTCGGCAATGCGACGCGGTAACGGACCTCTCGGCGCTGAGAGCAAGTTGCAGTCTACGCGAGCTCGAGCTCTCGGGCTGCACGGGATTTACAAGC
TCCGAGCTGCAACATCTGCCTGCACTTGACCGCCTTGTGCTGTCACGATGCACCCAACTGACAGAACTCGATGGCCTCACTCGCGTACGCGAGCTCGACG
TGAGCTTCTGCAAGAACCTGCGTTCGCTCGGGTCGTCACTGCGCCAAGTGCACAGCATTGGGGCCTACCGTTGCGAAAAGCTCGAGGACATCAAAGTGCT
GGCGAAGTCTGCCGAGTGCCTGACAAAGGTGAACCTGTCCGGGTGCAGTGCCATCAGCGACATCAGCTTCCTCGCCGGAGCGCAAGACGTCGACTTGCGG
TTCTGTGACGCCCTCCAAGATGTGCGTCCGCTGGCCCAAAGTGCTCGGATCGTCAAGCTCGCTGGATGCTCCAAGCTCGTGGACGTGTCGCCGCTTGCAC
ACGCCCGCGAACTCGATCTCAGCTACTGTCCCCGCATCGAGGACGTCTCGGCCTTAGAAACGGTTCACACGCTGTCACTGCGCCATTGCCCGAACGTCCG
CGACGTCACTGCGTTGGCCAACGTGCACACGCTCAACCTCTCCGGCTGCGTGCAGCTTGAGGACGTGTCGGCTCTGCGAAACGTGCACCAACTCAATCTC
TCGGACTGCTGCAAGGTGACGGATGTGAGCATGCTCACTGGCGTCCGGGTGCTGGACCTGCGCTACAACCGGGTGAACGACGAGGTCCTGAAAGACGGGG
TCGCGAAACTGCGCGGCCGAGTGCCCATCATCCGCATGTAG